Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4557
Length(NT) : 1127
Best Gene Model Blast : Link to GSTUMT00000078001 E-value : 0.0
Numbers of ESTs : 33

Blast Results:

Nr Definition: hypothetical protein BC1G_08870
Accession: ref|XP_001552392.1| Score: 1259 E_value: 1e-136
KEGG Definition: hypothetical protein [EC:6.4.1.4]; K01968 3-methylcrotonyl-CoA carboxylase alpha subunit
Accession: ani:AN4690.2 Score: 1206 E_value: 1e-130
KOG Definition:
Classification: [Lipid transport and metabolism, Amino acid transport and metabolism].
Kog Number: KOG0238 Score: 1121 E_value: 1e-123
PFAM Definition: CPSase_L_D2, Carbamoyl-phosphate synthase L chain, ATP binding domain. Carbamoyl-phosphate synthase catalyses the ATP-dependent synthesis of carbamyl-phosphate from glutamine or ammonia and bicarbonate. This important enzyme initiates both the urea cycle and the biosynthesis of arginine and/or pyrimidines. The carbamoyl-phosphate synthase (CPS) enzyme in prokaryotes is a heterodimer of a small and large chain. The small chain promotes the hydrolysis of glutamine to ammonia, which is used by the large chain to synthesise carbamoyl phosphate. See pfam00988. The small chain has a GATase domain in the carboxyl terminus. See pfam00117. The ATP binding domain (this one) has an ATP-grasp fold..
Pfam Number: pfam02786 Score: 606 E_value: 2e-63
Swissprot: Q99MR8|MCCA_MOUSE
Gene Ontology:
GO:0005743 = Cellular component: mitochondrial inner membrane

Sequence:
>Contig4557
TTGGCCTCCCCACCTCTAAGATTCGGATCCTCAACTTTCCATACTCATAC
TATACAATTCACTACTCCTCCTACTTGTTTCTCCTTCATTCCAGCTTTTT
TTTTTTTTTTCCCCAAAGGGAAATGCCTCGCCCACACCTTGCCCGGCGTG
CTCTACTGGGCCTAACACCATCCACCCTCCGTTGGCAGAGCAGCAGTGTT
CCAAAAGCTCGCCCGCTGACAAGTATACTCATTGCAAACCGTGGGGAGAT
TGCATTGAGAGTCAACCGGACGGCAAGCAAATACGGCATCCGAACAACAA
CCGTATACACAGATCCGGACACACATGCACAACATGCGAGTGTGACGCCG
CATTCTGTAAATTTGGGACCGCCGTCGGCCTACCTTGATGTCGATAAAAT
AATCAGGGCCGCAAAGGAGAGGGGGTGTGATTCTATACATCCTGGGTATG
GGTTTTTGAGTGAGAATTCGGCGTTTGCAAAGCGAGTCGCAGATGAGGGC
TTAACATTTATTGGACCACCGTCTACAGCAATTGAGGCTATGGGGAATAA
GAGCCAATCTAAAGACATTATGCTCAAAGCTGGAGTTCCTTGCATCCCGG
GTTACCATGGCTCAAATCAGGCCCCAGACTTCCTGCTCCAAGAAGCATCA
AAAATTGGCTTTCCTGTATTGATCAAAGCTGTAAAAGGGGGCGGTGGAAA
GGGAATGCGGATCGCAAAGACCCCCGCAGAATTCCCGGACATGCTTAATT
CGGCAAAGTCCGAAGCCAGGTCTTCATTCGGGGATGATGTGGTTCTCGTC
GAAAAGTACATTACTACTCCACGACATATCGAAGTCCAAGTATTTGCCGA
TAGTCACGGAAATTGTGTGGCATTAGGGGAACGAGATTGCTCTGTTCAGA
GACGGCACCAGAAAATTCTTGAGGAGTCGCCCGCGCCAGATTTGGACCCT
GTTCTCCGGAAAGACATTTGGGATAAAGCTAGAGCTGCGGCGCTCGCGGT
AGGGTACCAGGGCGCAGGAACCGTAGAGTTTATCTTCGACAACGATACCG
GGGAGTTTTTCTTCATGGAGATGAACACAAGACTGCAAGTCGAGCATCCA
GTTACCGAAGAAGTTACTGGGACAGAC

Sequences in the Contig:

SY0AAC11YA18FM1 SY0AAC13YM17FM1 SY0AAC18YD03FM1
SY0AAC19YO18FM1 SY0AAC1YI04FM1 SY0AAC26YF08FM1
SY0AAC27YF20FM1 SY0AAC30YM07FM1 SY0AAC31YC07FM1
SY0AAC35YI06FM1 SY0AAC37YH09FM1 SY0AAC40YM12FM1
SY0AAC42YD18FM1 SY0AAC43YG15FM1 SY0AAC46YM09FM1
SY0AAC47YE07FM1 SY0AAC4YC13FM1 SY0AAC54YA15FM1
SY0AAC54YK17FM1 SY0AAC57YH15FM1 SY0AAC57YI22FM1
SY0AAC8YL10FM1 SY0AAD11YL14FM1 SY0AAD12YK05FM1
SY0AAD24YM21FM1 SY0AAD2YH24FM1 SY0AAD30YI20FM1
SY0AAD36YI20FM1 SY0AAD43YL23FM1 SY0AAD45YB20FM1
SY0AAD51YL19FM1 SY0AAD52YE13FM1 SY0AAD7YL08FM1