Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4556
Length(NT) : 913
Best Gene Model Blast : Link to GSTUMT00006932001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_13443
Accession: ref|XP_001585559.1| Score: 237 E_value: 3e-18
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_2G04170 Score: 196 E_value: 9e-14
KOG Definition: No Hit Found
PFAM Definition: DUF1752, Fungal protein of unknown function (DUF1752). This is a family of fungal proteins of unknown function..
Pfam Number: pfam08550 Score: 402 E_value: 6e-40

Sequence:
>Contig4556
GTGCGTGGCGAAAGTGCAGGTGGATGCATGTTGCTAGTAGTAACAATGAT
TGGCTTCGAGTGGCTAACCCCAGCGGCCGCCTTGGAAATCAGCGAGGATT
CTTTGCGGGGTGAAGCGGCGAGTGAGGGGCCTGAAGGCGAGGTATTGCGC
GATCGGATGGCAGGTGTCGAACGGGATCCGCCGTTTGTCAGCACGGGTGC
TCGCTTAGGCTCATGGAGCAGGGTAGACAGAAGAGAACGGCGAGTGACAA
GTTGAGGCCGGCTTTCTACACGTTGGAACATAGCGGTTTCAGTGTAGCTG
GATTGTGCGCTATCGGTAGATGATTCCCAGTCAGAGGAACAATCATCATC
ATCCTCAATGGCACTCTCTGAAACGTTCTCATCGTCATCACTGAATGTGT
CCTCATCGTAAACTGTTCGTGTGGCAACCTCGTCTCTGAATGATGTCCGC
TTCTTCTTGCCTGCTATCTTCAGTCCCTCCGCCAGTCCGCTAACCTGAGG
GTCCCGACAGCTGTTGATGCTGAAGCTATGATCCATATCCGTCTCATCGT
CAGATACTGATGAAGGTGATGAACCAATGATCCACATTTTCTTTGACTTC
TTGGGCACCACCGATGCCTTCACTGGACTAGGCTCCGGTGCCATCCTTGT
TTTTGATCGGTACGATGAAGATACCTGCCCAGGTGAAAATCCACGGACGA
CACTGTGGCTGCTTTGCTCCGATGACTTACTCGACTCCGACCCTACGGGA
GATGCACGATCGGCAGTAGAAGACATGGGGGATACTGAAGCCATTGAAGT
AGCTTCTTGTGCTGGCACGGAAGGCTCCGCATCGGTTGAAATATGTGTGT
TGATGAAACTCCTTCTGGAGATCCAATCCTCTGCACTCGACTTGCTCCTA
TCCAAATCCTCCA

Sequences in the Contig:

SY0AAC2YI24FM1 SY0AAC35YH14FM1