Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4555
Length(NT) : 848
Best Gene Model Blast : Link to GSTUMT00005242001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein AN5578.2
Accession: ref|XP_663182.1| Score: 507 E_value: 1e-49
KEGG Definition: hypothetical protein
Accession: ani:AN5578.2 Score: 507 E_value: 7e-50
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG2184 Score: 333 E_value: 6e-32
PFAM Definition: TFP11, Tuftelin interacting protein 11. This family contains tuftelin interacting protein 11 which has been identified as both a nuclear and cytoplasmic protein, and has been implicated in the secretory pathway. Sip1, a septin interacting protein is also a member of this family. Proteins in this family often contain pfam01595..
Pfam Number: pfam08697 Score: 463 E_value: 5e-47
Swissprot: Q9UTK6|YKR3_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig4555
TTGGTAAAGATCCTTCTGTTGAAGACGAATCGTTTAAGATTGCTAGAATG
GCTCGAAAGGATCTCGAGAGTTTTGCAGGGGAATGGGCGAGCCTGCAAGA
CCGGAAGACCTATATTAATAAAGAGGAGAGAAGGTTGAATTTGGAGATGG
ATGAGGAAACAAAGCAGATCGGAAGATTAAAGGACATGGTGGATATGGCG
AAGAGTCTTCAGAGCCTCACTTTGAATATCGAAGACCCAAAGGCTTCTAT
CGAAGCAATCGTAACGCAGCTAGAGGTACTGCAACTTGAGTACCAGAACG
AGATAGAAGACCACGACTTGACCGGAGTAGCAGTCGCGGCACTGCACCCA
CTTTTCAAACGGGAGCTTTCCAGGTGGTCCCCTCTTAAAGATCCGTTCCT
GTTATTTGAGAGCTTCCGCAGGCTTCGTCGTATACTCCATATACGATCAA
AGGAAGACGTCGAAGCAGAGTACGCTAAAAAAGGTTTCGTAGAGCGAAGC
AAGTCTACAACTCATTATGAGAGTATGATGTTTTCTCTCTGGCTTCCGAA
AGTGCGATCAGCTATCAACAACGATTGGAATGTACATAAACCTGCACCAG
TACTAAAAGTATTGGATGTTTGGACTTCTCTTCTTCCATCTTTTATTCAT
GCCAACATCCTCGACCAACTGGTGTTACCCAAACTCCGTGCGGCAGTTGC
CGATTGGAACCCCCGCGTGAGCAAAGGGAATAAGGCTCGCCAGCCTCCCC
ATCTATGGGTCTTTCAGTGGCTGCCACATTTGGGTCCTCATATGGATGAT
CTCCTCCGTGAGGTCAGGAGGGGATTCGGGATCGTTCTGGATACTTGG

Sequences in the Contig:

SY0AAC35YH08FM1 SY0AAC51YM18FM1