Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4554
Length(NT) : 1585
Best Gene Model Blast : Link to GSTUMT00000054001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: transcriptional regulator (Cti6), putative
Accession: ref|XP_001274169.1| Score: 390 E_value: 1e-35
KEGG Definition: PHD Zn-finger proteins
Accession: aor:AO090020000452 Score: 375 E_value: 4e-34
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1844 Score: 195 E_value: 1e-15
PFAM Definition: PHD, PHD-finger. PHD folds into an interleaved type of Zn-finger chelating 2 Zn ions in a similar manner to that of the RING and FYVE domains. Several PHD fingers have been identified as binding modules of methylated histone H3..
Pfam Number: pfam00628 Score: 131 E_value: 3e-08
Swissprot: Q08923|CTI6_YEAST
Gene Ontology:
GO:0000508 = Cellular component: Rpd3L complex
GO:0035064 = Molecular function: methylated histone residue binding
GO:0008134 = Molecular function: transcription factor binding
GO:0016575 = Biological process: histone deacetylation
GO:0045941 = Biological process: positive regulation of transcription

Sequence:
>Contig4554
TTGGCTTCTATTCAGTATTCCACCATAATTCGTTGTCTTCTTACTCACCC
CACCTCGTTCTCGGAGTTCCTAATTGCCAGTCTTCTAGCTCAATCTCTGC
TATTGTCCACTACACACTCGGGGCTTCTCTTCGCCAGCTTTTTGCTCGGT
TTTTACTCTCCCCTTTCCCACTTCATCCCCCCCCTCACCCCCCATCTCCC
ATTCCTCTACCTTCACCTCGCCCTCACCTTTTACGAGCCAGCAATCATGG
TCTCTCCTCGCCGCTCTTCCCGCGCGCGCTCTACAGCAAATCCAGCGCCA
GTTTCTCACTCATCCTCCTCCTCATCGACCTCATCGAATCGTGGCCGCCT
CCAAAAGCACCACGAAAATGACTCTCATGGCGACCACGAAATGGGCCACT
CCAGGCGTGGAGACCAAGGAGAGATTCCTTTCGAATCTCGTCTAGAATCC
ACTGCAGAGGTCAACGGTACAGGCGATGAAGAGATTGACGATGCAGGATC
ACAGGAAGACGAAGTCACACGTTGTATTTGCGGTCATCAGGAGTACCAGG
CTGGTGATGACGATCAGGCCGATTCGGACGGTCTCTTCATTCAGTGTGAC
CAGTGCCATGTTTGGCAACACGGTTTTTGCGTAGGAATCACTGACAGTGC
GTCCACTCCAGAAAACTACTATTGTGAGCGATGTAAGCCCGAATTGCACA
AGCTGGGGACCAGTAAATCTGGAATGAGAACATCCCTTTATTTGCCAGTC
CACTCAGAGCCGTCATCACCCCTAAATAACAAGGAAATTCCTCACAAGCG
TCGGACTACCATGAACTCTCGTGATGCCGAATATGATGACGCTATCCTCA
AAAAAGTTTTAGAGGAAAGCAAGAACGACAAACTTTCTGGGAGTTCGACA
CGTGGAACCAGTTCAAGAAGCCGAAAACGAGGTACCAGTGAAGGCTCCGA
CGAACCAAAGCAGGATTCGAAACGACGAAGAACCTCGGATTCACCAGACA
CTCCAACCAATGGGCCCATCGAATCAAGTGATGAAAAACCTGGGAAAGGA
ATTACAGCCCCCTGTTCGACCAAAAAGTCGCGAGGCGCATCCTCTCGTCA
TTCGAACGTAAATTTATCTGCTGCAGGGAAACGTACCTCGACTAGAAACA
GGAACGGAGATAAGGGTAAGGAAGCTAGAAAAGAAGAATCAGAACATTCA
GACGAGTACCCTCCTCCACGTTCCAACAATCGGGCAACAAACAAGCCTAT
AGAAGAAGTTATCCTCCCACCACCCACCGTGCAGACTGCGCCAGATACCC
CCCAACAGCCGGCCAAACGGTCTGCTCGCAACGGGAACACCAGTGGGCAT
GGCGGACGTCGCCGTGTAAACCATCGCCATCGCCAGTCAGAAGATCCAGG
TGATAATGGTGGAGCTTCTCCTCATGTCATGACTCGAGATCATTCTTCTG
CTGGGGGCAATCAGGGTTCAAAACCCATGGACCACGGCACCATCATTGAT
AAGCCAACTAAGCCGAGAATTCCGCAAGCAAGAATGAGCATAAACGAGAT
GGGAAGGCGGGTTCGCGGCATCTCGGACTTCATCA

Sequences in the Contig:

SY0AAC23YH15FM1 SY0AAC35YH02FM1 SY0AAD38YM07FM1
SY0AAD46YL21FM1