Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4553
Length(NT) : 826
Best Gene Model Blast : Link to GSTUMT00009708001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: YlHIS1
Accession: ref|XP_501464.1| Score: 545 E_value: 5e-54
KEGG Definition: HIS1; ATP phosphoribosyltransferase [EC:2.4.2.17]; K00765 ATP phosphoribosyltransferase
Accession: yli:YALI0C05170g Score: 545 E_value: 3e-54
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG2831 Score: 493 E_value: 2e-50
PFAM Definition: HisG, ATP phosphoribosyltransferase..
Pfam Number: pfam01634 Score: 263 E_value: 7e-24
Swissprot: Q99145|HIS1_YARLI

Sequence:
>Contig4553
TTGGATACCAAGCTGTTATCAACCCCTCACCCACTCACCCCCTTCGTTAC
TCAAACAACCCCTTTCCTTCTCGTACTAGTACATCATCCCACACATACGC
CTTCTTCCGTCCGATCTCCCTCCCTTAACGGAAAGAAAAGGAACCGCAAA
AAAAGAAAAGGAGGAAAAAAGGAAAAAAGACTACTTGAAGATCACACAAT
GGATCTTGTCAATCACCTGAGCGACCGCCTCCTCTTTGCCGTTCCCAAGA
AAGGCCGCCTCCACCAGAATTGCCTCGACCTCCTCCACGGCGCCGACATC
CAATTCCACCGCCACAGCCGTCTTGACATAGCCCTATGCATCAACCACCC
CATAGCGCTCGTCTTCCTCCCGGCAGCCGACATCCCCGTCTTCGTCGGCG
AGGGCCGTGTGGGTCTGGGCATAACCGGGCAGGACCAGGTTGCGGAGTCG
CAAGCGGACGTGGAGGAACTGATGGAATTGGGCTTCGGGAAGTGCAAGCT
GCAAGTGCAGGTCCCGGAGAAGGGCCCGATCCAGGTGCCCAGGGAATTAA
TCGGGAAGAACATCGTCACGAGCTTCACGCTGTTGGCCAGTGAGTATTTC
GCCAGGTTGGAGGAGCAGGTGAAGGATGGGGTTGGGAGTGACAATGCGGA
GGAGAGGGGGAGGAAGGAAGGAGGAGGAGGTAGCGGAGGGGTGGGGGAGT
TAAACTTGAATGCTCTGGAGAAGACAACCCCTAGAGCTACTCCCAGGGCT
ATTAAGGTAGACGGTACAGTTACCAGGATAAAGTATGTCGGTGGAAGCGT
CGAGGCTGCCTGCGCTCTCGGTGTCG

Sequences in the Contig:

SY0AAA49YL05FM1 SY0AAB56YK20FM1 SY0AAC35YG23FM1
SY0AAD46YE10FM1