Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4552
Length(NT) : 1767
Best Gene Model Blast : Link to GSTUMT00007634001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE62917.1| Score: 1180 E_value: 1e-127
KEGG Definition: predicted protein
Accession: aor:AO090120000325 Score: 1180 E_value: 1e-127
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q03722|YMC0_YEAST

Sequence:
>Contig4552
TTGGACAAAAGGCAAAGGCTAGAGAAATATCTCCGATCTCAATACCCGAC
CCCAAGATGACTCGGACCCTCAACAACTTGCGTGAGGAGTCCCGTCCAGG
CACACCGAAGAAGGCGGAAGCAAACACTTCTATCGCGGCTACGGTCTCTG
CCATCCCCAAACCAACACCATCCCCTTCACCGAGTAGTGCAAGCACCGCG
AAGCAAAAGCTGCAAAAGATCTTGCCAGCGAACCATGTCCTCCCGAATTT
TGATTCTTGCTACCGGCGCTTGAATCAGCCTTCTATTTTTTGTCAAATCA
CCAAAATCTTCAAGAGCCAGCCCCCTCCCAACAAGAAGCATCTTTACCTG
ACGCCCACACCTCCTAGGATCAAGAAGGCTGTTGCTATTGGGGTACATGG
CTTTTTCCCAATGCGCCTGGTCCGAACGGTATTGGGGGAGCCGACGGGAA
CGTCGATTCGTTTTGCTAACTCTGCTGCAGCCGCTATAAAGAGGTGGGCT
GAGAAGAATGGTGTTGAGGTCGAGATCGAGAAGATTGCTCTGGAAGGCGA
GGGAAAGGTTGGGGACAGGGTTGAGATGCTATGGAAACTACTTGCAAACT
GGATGGATCATGTGAAGAACGCGGATTTCGTGCTAATGGCAGCGCATTCA
CAGGGTGTGGTGGTGGGGGTTCAGTTATTGGCGAGGCTCATAGAAGAAGG
GTGTGTGGACAAGGCAAGAGTAGGATTCACAGCAATGGCAGGAATCAACC
TAGGACCTTTTTACCATCTCCCAACAACTATCTTGACCGGGTCTGCGAAG
GAACTCTTCGAATTTCAGAGGCTGGAGAGTATTCCATCGAAAAAGTACAT
ACAGGCCCTAAGGATCTGTCTCGCGCAGAATGTCCGGATCCTCTACGTTG
GTAGTATAGACGACCAGCTAGTCCCTCTCGAATCATCAACATTCTCAAAC
ATTAGCCACCCGTACATTTTCCGGGCAGTTTTCGTGGACGGCAGGGTCCA
TGCGCCGGATTTCTTGAGCCATCTTGTAGGATTCGCAATGAAATTGAGGA
ACCTTGGTATATCTGATCATGGCTTGGTTAGAGAACTAAGTTCTCCTCTG
GCTGGAAGCTTATATGGCGGTGAGGGGCATTCCCGGATCTACGACGACAA
CGCTGTCTACGACCTCGGCGTCCGTCACGCCCTGGAAACAACCGACTGCC
CAGACGTCCCGCTAGGACTAGATACGTTCGAGCTGCCAACAAACAACAAC
AACCCCTTCCTCCTCCCCTGGAGCATGAGGGGCATGCTAGAGGAACCGCA
CGTAAAGAGCAAACTAGAAGGCGAGTGTGCTGAGCTACTCGATCAGTTCC
AAAAGTGGAAACCTACCTCCAAGGTTCTTAAGGATGTCAAGTTTAGATTA
GAAGGTATCAGGAGTAAAATTTGAACTTTAGATCTTCATATGGTGCACGC
ATGGAAAGATTGAGTGGGAGGGGATTGCTCTGGGATATACTACATTACGG
AACGGCGCAAATTAAAAAGTGACTTTTTTTTTCTACATCCTCCGGCTGGT
GCGATTGTTTGGGGGTCTCTATGTGTCGCGATTAGCTTAGGTGTTCTGGA
TTCTTTTTTTCTTTTTCTTTTTCTTTTTCTTTTTCTTTCGATGTAGGCAT
AGTTTCTTTTGCTCGCTCTCCACATTAACAGTATGAGTGGGCACAGTGCA
GTAGTCAGGGTGTGACGCACGGGGAAGCTTCATGACTGATGATGGGTGGT
ATCAGATGAGTCACTAG

Sequences in the Contig:

SY0AAC35YF11FM1 SY0AAC43YC19FM1 SY0AAC48YE17FM1
SY0AAD18YA05FM1 SY0AAD30YN05FM1 SY0AAD36YC22FM1
SY0AAD8YA20FM1