Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4551
Length(NT) : 3721
Best Gene Model Blast : Link to GSTUMT00002340001 E-value : 0.0
Numbers of ESTs : 50

Blast Results:

Nr Definition: hypothetical protein BC1G_07088
Accession: ref|XP_001554500.1| Score: 1904 E_value: 0.0
KEGG Definition: hypothetical protein
Accession: ang:An04g05530 Score: 1759 E_value: 0.0
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG3607 Score: 499 E_value: 2e-50
PFAM Definition: Disintegrin, Disintegrin..
Pfam Number: pfam00200 Score: 301 E_value: 2e-27
Swissprot: O13766|MDE10_SCHPO
Gene Ontology:
GO:0005789 = Cellular component: endoplasmic reticulum membrane
GO:0005619 = Cellular component: fungal-type spore wall
GO:0030476 = Biological process: ascospore wall assembly

Sequence:
>Contig4551
TTGGCTTCCTAATAAGTGACACCAGGCCGCAAAAACTAGGGTACCCGAGT
ACTCTTCCCCGTTGCTGTCCTCGTCGTCGTTGTCGCCGCCGTAAAATAAA
TTAAAAAAAGGCTCAGCAACGCACACACACAAGACAAGACACACACACAC
GCAATACAATACAATACAATACAGTAGGATACGGTACTCGAGTACAATAC
AATACACACAGTTTCGCTGATTCCATTCGCTGCCCTTTCTCTCCCTTCCA
CCCCCCCCCCTCTCTCTCCCCTTCTCCTTTCTTTCTCTCTTTCTTACCTT
TTCTTTCTTTCCTTTTACCCTTTCCCGTCTAAAAGAGGGCAAAGTGATTA
CAGATTTTGTTGCTTTCTACCCATTGTCTCCGAGTTGGCCGCTCAACGCT
TTCCCTCGCGCCTGCCGTTGTTGCTATTTTATAGCCGAAAGAATTTGGAA
GACTCGCCGGGCTTGTTCGCATCCTGTGCCTTGCACTGGACGACTACTGC
TTAGTCGGGGTTTCTCTTTCAACCGGCCTGGTGGTCATCCCACCTGTGAG
CCTCCTTGAAATTTTTCGTTAATACACTGGGGGTCATCCTGTTTATTTCG
GCCCTTTGCCCTCTTACACCTCCCCACCTCTCTTCTTCTTTGCGTTCGCG
CATATACACACATTACATCCGCTACAATGCGCTTACCACCACCATTATCG
TCATTTCTGTGTGGGCTTTCTTTGTCTGTACTTTTAATAGATGTAGTTAT
AGGACATTCGCAGCACCGAAATCCTGTGTCGTACATAACTTTTATTGAGG
ACCCTGAGATAATCACTCCCGGCAAGCGAATACACTCGGGTTCGTCCTTC
GACTTGAAATTCACGCTACACAAGGGGGAGCAGCAGGTCAAGTTCGTGCT
CGAGCCGAACCACCAGATATTGCCCGACGATGCAAAGGTCGAGTACCTGG
ATGAGGATGGGAATACCAGGCGCTCGGAGCGCATTAATCGACGTCACATA
AAGGTTTACCGGGGGACTTCTTGGCTGAGGAGCGAGCTTAAGGATGAGTG
GATCCATGCCGGATGGGCTAGTGTTGTGTTTACGAGGGATGGGGAGGATC
CGCTGTTTGAGGGGGCTTTCACCCTGATGCACGACGCTCACCACATTCAG
TTCCGATCCACTTATAGGAGGACTAAACATGCCTTGGATCCGGATGTTGG
ACCGGAAGGAAAGGAGGGAATGGTTGTTTTCCGGGATTCGGATGTTGTGG
ACAGGGATCTCTACAATCAAGGTCTCGTGGGGAGAGGGGTTGGGCAGTGG
GATGACAGCGCCGGGGTTATGTGTCCGGCCGATAGATTGGAATTTAATGT
TCAACCGGGACACTTGGTTAATAGGATGATTCTGGAGCCGGAATTGCCCA
AGGGGCGGCTGTGGGCGGGTATCGGGTTGGAGGATTTATTCCAGGGCGGG
CTGAAAAGGAGGCAAAACCTAGAGGGAAATGATGGGTTTACCGGCGGCAC
GGGAAACTCTGCCGGTGTAAATTTGCGTAATACGATTGGGAATACAGACG
GCTGCCCGAGCACAAGGCTGGTCGCATTGGTTGGCGTTGCCACTGACTGC
ACTTACACCGCCGACTTCGAGGGCGACCAGGAGAAGGCTAGAGCGAACAT
CATCACACAGATCAACTCGGCATCTAACCTTTTCGAGAAAACCTTCAACA
TCACGCTCGGCCTTTCGTCTCTCGTCATCAGCGATGCGAATTGCCCGGGG
ACTCCCCCAGCGACTGCAAAGTGGAATATCCCGTGCTCGTCTGCTAATTC
GAGTATCGAGAATCGACTGAATCTTTTCTCCGAATGGAGGGGTACCCGGT
CGAACGATTCAAATGCTTTGTGGACCTTGATGACCACTTGTGAGACTGGA
TCTGCCGTTGGGCTCGCCTGGTTGGGCATGCTGTGTCAGAAGGATGCTAT
TGTTCAAGCGGGACAATTCATCTCCGGGGCCAATGTTATTGCCAGGACCT
CGACGGAATGGAAGGTTATTGCTCATGAAATCGCTCATACCATGGGTGCC
GTGCATGACTGCACGTCCTCCACTTGTTTGGGAAATATTGCTTCCGCATC
CATGTGCTGTCCGCTCTCCTCGAATGTTTGTGATGCTGCAGGGAGGTTTA
TGATGAATCCGACTACCACCGATACCATCTCGGGTTTTAGTCCATGCACT
GTTGGGAATATTTGCTCAGCGTTTAAGAGGAAGAGTGTTGATATGTCCTG
CTTGACATCCAACAGGGACGTTAGCGTTATCACGCAAGATGAGTGTGGTA
ATGGTATCGTGGAACCCGGCGAGGATTGTGATTGTGGTGGAACGGAGGCC
TGCGGAACCAACTCCTGCTGCGATCCTACCACCTGCAAGTTTAAGAATGG
CGCCGTTTGCGATGATGCGAACGAGGACTGCTGCACGGGTTGCAAGTTTG
CGTCAAAAGACAAGGTCTGCCGATCTAGCAACGGCCCCTGTGATCCCGAG
GAGAGATGCACGGGAAGGAACGCCACCTGCCCGTCAGACGTCATTTCGGG
AAATGGCGATTCCTGTGGCGATGGACTGCAGTGCGCGAGTGGGCAATGCA
CATCTCGAGACCTGCAATGCAAGACGGTTATGGGGCAGTACCGGAGCAAC
AGTACACATTCATGCACGGATACAGATTGCCAGCTGACTTGCGCATCCCC
GGAGTTTGGCCCGGGAACCTGCTTCCGGATGCAGCAGAATTTCCTCGATG
GGACTCCATGTAACGGTGATGGGAGGTGTAAGGCTGGAGTATGCAGTGGC
TCGTCAACACTTGGCCAAGTTAAGAGTTGGATCAATAAGAACAAAAACAT
CGTAATAGGCGTATCAGTCGGTATAGGCGCCCTGGTAATCTTTTCCATCT
TCTCCTGCATATGGAGTTGCTGTCGAAGAAGGCGAGCACGCAAGGCCGCG
TTGAAGAGCCCGCCGCGTCCACCCACAGGTGGGTACCAACCGCACGACCG
GGCATGGCACAGACAACGTGATGCAAACACGGGCGTGTACCCTATGCCCC
CGCCACTATCGCACGCGTCTCATCAAACGAGGAGTCCGCCCGCCTACGGC
AATGCGGGCTTCTCGCCTGGTATACGATCGGATCGATACGCTTGAAGTCA
AGTAAAGCATGATTCTGGGTGTTTCTTTGCGCACTTGTACATGATAACGA
TACGATGATTAGTGTTTTTTTTTCTCTCTTTTTTTATTCATCTCTTTTTT
CTCCGTTGAGTGGTATTTGAGGGATAAGTTGGTTATTGGTTTTTATTTTT
ATTTTTGGCCTGGTCTAATAGTCCGATTGATTGGTTTGCGGGCTTTGTTG
GTCTGGTTGGGCGGTTGGTTGGTTTGGGCTCTTTTTCCTTTTCTCTTTTT
CCCCTTCTGTATGTATGTATTTAGTACACCTACTCACCCCTCTTTTTCTC
GTTTTTTCCCCTTCACTTCCCCATTGTGGCATCTGTGTCATTTCTTTTAT
ACTTTCCTACAGAATGGGGTTTGGGATTTAAGATTGGATTGGATGGAAGG
TTAGATTTTCAGGGATGGGGGAACGGGGAAATTTAACAAAGCACTATCAC
TGGGGCAGCACAGCACAGCACACACTCTGAATACCCGAGCGTCTATTCTT
CCTCTTCCCTTCCCCTCGTGTCGGTAGCGGGCGGGAGGGGTGTATAGTAA
GTAAATTACAATATTACCATG

Sequences in the Contig:

SY0AAA13YO07FM1 SY0AAA16YA07FM1 SY0AAA18YE24FM1
SY0AAA1YH13FM1 SY0AAA22YE04FM1 SY0AAA46YE15FM1
SY0AAA48YP22FM1 SY0AAA53YK22FM1 SY0AAA55YM21FM1
SY0AAB10YK07FM1 SY0AAB13YC23FM1 SY0AAB28YL23FM1
SY0AAB33YK09FM1 SY0AAB44YG14FM1 SY0AAB51YA12FM1
SY0AAB55YI19FM1 SY0AAB9YD01FM1 SY0AAC12YB20FM1
SY0AAC14YH21FM1 SY0AAC15YB16FM1 SY0AAC16YB04FM1
SY0AAC16YH08FM1 SY0AAC19YB09FM1 SY0AAC19YB09RM1
SY0AAC28YC14RM1 SY0AAC2YC22FM1 SY0AAC31YF13FM1
SY0AAC35YF02FM1 SY0AAC38YM12FM1 SY0AAC40YB02FM1
SY0AAC42YO10FM1 SY0AAC47YM09FM1 SY0AAC47YN01FM1
SY0AAC51YF16FM1 SY0AAC52YN13FM1 SY0AAC59YM21FM1
SY0AAC60YM09FM1 SY0AAC62YN19FM1 SY0AAD11YN22FM1
SY0AAD15YN15FM1 SY0AAD20YC24FM1 SY0AAD24YK20FM1
SY0AAD25YH05FM1 SY0AAD28YG21FM1 SY0AAD45YE01FM1
SY0AAD46YI11FM1 SY0AAD56YF19FM1 SY0AAD59YK01FM1
SY0AAD61YI01FM1 SY0AAD61YJ20FM1