Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4550
Length(NT) : 921
Best Gene Model Blast : Link to GSTUMT00000476001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein MGG_04759
Accession: ref|XP_362314.1| Score: 679 E_value: 2e-69
KEGG Definition: hypothetical protein
Accession: mgr:MGG_04759 Score: 679 E_value: 9e-70
KOG Definition:
Classification: [Cell wall/membrane/envelope biogenesis, Posttranslational modification, protein turnover, chaperones, Signal transduction mechanisms].
Kog Number: KOG1550 Score: 119 E_value: 4e-07
PFAM Definition: No Hit Found
Swissprot: P38213|YBL7_YEAST
Gene Ontology:
GO:0042802 = Molecular function: identical protein binding

Sequence:
>Contig4550
CCCCGATTTCCCACGAAAATTTGACGTACCCTTCTACCCTATCATGAATA
TCTGTCTTGCGCAATACCCGCATGGGCATATGTTTGGTTGATCGGGCGGG
GAAGATTACAATACCATGATCAAGATCAATTACGATAATGGATGGATAGA
TGGGAAGATGGATAGAAACGGTAAAAGCTAACTAACGAAAACAGAGCTAG
GAAGGTCTACAGCAATCTTCGGACGTCTCGCAGATCCGAACGGCCCAAAC
AACCCACTATCCCAAGTTCTCTATGGACTCGCCCTCCGTCATGGCTGGGG
CATAGAACCAAACCTCCCCCGCGCGCTAACCTACCTCCAATCCGCCGCGC
GCAATTCCGCCGCTGTGGAAGAGCTAGCCCTAAAAGCCGGCATGACCAAG
GGCGGGAGCGCAAAGGGCGAGCTCGTGCTCGCGATATTCGAGCTGGGGAA
TTGTTTCCGCCACGGCTGGGGCGTGCAAAAGGATCCCGTCGCGGCGCGAG
AATACTACGAGACAGCGGCGAACCTTGGGGACGCGGATGCCATGAACGAG
GTCGCATGGTGTTATTTGGAAGGCTTTGGATGTCGGAAGGATAAGATGAA
ATCCGCAATGTTCTACCGTATGGCGGAAAAACAGGGCAATAAGATTCTTG
GAAACACTTGGATATACAAGGACAAATACATGACCGGCGGTTGATGGTTG
GATAGATGGATGGATGCATTACATTGGAGATTCGGGTTTAGTTAGTTCTT
GTAAGGGAGGCTTTTTCGATTTCCAATTTCCGATTTTCGATCCTCGATTT
CTTTTTATTTTCTTTCCACTCCTCGTATGATACTCACTTTGTTCTCGTAC
TCGAGCATCACACTTGTATCTAAGCGTAGTCTAGAATACCCATCAGGATA
AAGTCAAAACCTATCATACCT

Sequences in the Contig:

SY0AAC31YA12RM1 SY0AAC35YE23FM1 SY0AAD29YK06FM1
SY0AAD33YN06FM1