Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig455
Length(NT) : 1367
Best Gene Model Blast : Link to GSTUMT00012127001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001266045.1| Score: 341 E_value: 5e-30
KEGG Definition: conserved hypothetical protein
Accession: afm:AFUA_5G05910 Score: 298 E_value: 3e-25
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0771 Score: 298 E_value: 1e-27
PFAM Definition: No Hit Found
Swissprot: P11655|SEC12_YEAST
Gene Ontology:
GO:0030176 = Cellular component: integral to endoplasmic reticulum membrane
GO:0000299 = Cellular component: integral to membrane of membrane fraction
GO:0005085 = Molecular function: guanyl-nucleotide exchange factor activity
GO:0006888 = Biological process: ER to Golgi vesicle-mediated transport
GO:0030433 = Biological process: ER-associated protein catabolic process

Sequence:
>Contig455
TTGGGTGAGAAAACGTGATCGCATGTTTAGGACCAAATGAGATGGCTCGC
CAAGAATGAGGCTCAAATTTCAGGAACACGTCGACAGCTTCTCTTTCCCC
CAAGAGTTGGTCTTGTCTTCTTTCTGCCACAAAAGGCTCCCCTACCCAAC
GATTTAACCTACAACATGGCACCTTCGATAACTTCTGAGAAGCTCACACT
TTCATACCCACTGTTCGGCGCATCCTTTATCGATGCTGACCGCTTGCTTG
TTGCTGGTGGGGGGGGCGAAGGGCGTAGCGGTGTTGGTAACAAAATTACG
GTGCTAGATACCTTGACGAAGCCGGGAAAACCTTTAACGGTGACGTCGGA
AATCGAACTTAGTAAAGATGAAGACGCCGTCATGTCGCTCTCAGCTCTGA
GCACCTCGTCGGGAGTCAAAGCACTCGCTGGAATTAACTCTTCTCAAAAA
GCCAAGTCGAACGAACATTTCCGGGTCTTTGATGTTCCGAAAGAAGGCGA
GATCAGTCTTGCTTCCAAGCACGCATTGTTCAGTCACCCAGATGCAGAGA
CGTATCAGCGACTGGTCCGTGTCGACGGGGAGGGAAAAGCGGCGGTTATC
GCGAGCGGGAGTGGGCTGGCGCCGGCTTCGGCGTCGGAGGTTGTGATTAT
TGATGTTTCCTCCTTGAGCGTGAAGCGGCGGATACGATTGCCTGGGAAGG
AAGAGGTTGGGGACGTGGATATATCGAGGGACGGGAAACGAGTGGCATAT
TGCTCACCGGGGGACATCTACATCGCATCTACGGAGAAGGAGGAGCAGCG
CTTAGAACCTATCGCCTTGAAATGGAAGAGCTCAGACAGGCCGAAGGGCA
GCTTCCGGTCCGTTCGGTTCTCCAACAACGGTGGACTGGCGGTAGTGTAC
AATCTTTTCGGACGCTCGGGTGCCATTATACTACTCATCGATCCTTCGGG
GGAAGTCATTTCAAGACGAAACGTACACTGCGGGGTAAAAGCAGTTACTA
GCGTGGACTCCTTAATGCTCTCGCCAACTAGCACACTTCTGGCCGTCGCT
GGTGCAGACAGAAGCGTCCAACTATTCCTTGTCGGAGGACAAATTAAGGC
AGTCAAAACTTTCAAAGATGTGCATCCCTTTCAAATTACCAAACTTGCCT
TCTCACCTCTCCCATCCTCCGGCACGACTGTCAAATTGGCAACTACATCG
ATGGGCAACACTGTCGTTGTATTTTATATTCCAGTGTTCGAAACCGAGGG
TAAATGGCAGCTCCGACAAACCTCCGTGAAACTAACCGCCTTCCTGGTGT
TGATCTCACTGGTTGGCGTGGTTGTATTCGCGATCGCCCTACAGCTAATG
TTTAACGCGCGGGCAGG

Sequences in the Contig:

SY0AAA1YK24FM1 SY0AAA24YG04FM1 SY0AAA24YG04FM2
SY0AAA43YF02FM1 SY0AAB36YB12FM1 SY0AAD51YF18FM1