Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4549
Length(NT) : 699
Best Gene Model Blast : Link to GSTUMT00011590001 E-value : 0.0
Numbers of ESTs : 10

Blast Results:

Nr Definition: hypothetical protein CIMG_07170
Accession: ref|XP_001243274.1| Score: 287 E_value: 3e-24
KEGG Definition: hypothetical protein
Accession: ncr:NCU05498.1 Score: 255 E_value: 9e-21
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4549
TTGGCTCAAAAGCAGCCAGAAAAATTCACTTCCACCATCAAACACCATCA
TCAAACGCAGTGAGATTAGTCTCCATCAAACAAACACTCAACAATAATGG
CCGCTACCAAATCCAAGTCCGATGTCCCTCCTGAAAACCAAGCTCCATCT
AGCTCTAAGGCCGCCGCAAAGGGAAGTCACCGTAGGGGGAGTTCTTCCGT
CACCGACGTTTACAAACCAGCTGAACTCAAGGACATCATCGGAGAGGAGG
GAACTTTAATGGTTGCCAAAGAGATCTCTAGATTGAACTGGAAATTGAAT
ACCCATCCCTCGCATCTCGATGACTGGAAATCTCTCAAGGAAATCCCAAT
AACCACCCCCAAAGTCAAGCTGTTAGACGTTTACTTTCCTCTCGGATTGC
ATGTCACCGCCCGTGCGGGCTCATCCTCCACTGTTGGTGTTAGTGTCTAT
GACGTGCTGGTCGCGATTCACAAGCAGTTCAAGAAGAAAGCGGATGACGA
ACTTGAGATGCCCGTTCTCGGAAACCTCGAGTGGGGCCGCTCTGAGGATC
TTAGTAGCAAGGAGCACTGGCCTGCTGTTGTCCTTGTGGCGCAGAAGAAG
GAGGCGCCCGTTACTGGGAAGAAGAAGAATTAGTCTTCTTAACACTCTTA
GTTGCTAGATCACTTCTATAGAGGTTTTCTGAATAAATCCTGACCGGTG

Sequences in the Contig:

SY0AAB17YF10FM1 SY0AAB39YA14FM1 SY0AAB42YI10FM1
SY0AAB50YG13FM1 SY0AAC35YE12FM1 SY0AAC46YB23FM1
SY0AAC47YB22FM1 SY0AAD13YJ16FM1 SY0AAD51YL08FM1
SY0AAD60YI13FM1