Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4546
Length(NT) : 2166
Best Gene Model Blast : Link to GSTUMT00002283001 E-value : 0.0
Numbers of ESTs : 30

Blast Results:

Nr Definition: hypothetical protein CIMG_09213
Accession: ref|XP_001239592.1| Score: 1355 E_value: 1e-147
KEGG Definition: NITROGEN ASSIMILATION TRANSCRIPTION FACTOR NIT-4
Accession: ncr:NCU08294.1 Score: 1292 E_value: 1e-140
KOG Definition:
Classification: [Signal transduction mechanisms, Cytoskeleton].
Kog Number: KOG3671 Score: 124 E_value: 3e-07
PFAM Definition: Fungal_trans, Fungal specific transcription factor domain..
Pfam Number: pfam04082 Score: 232 E_value: 9e-20
Swissprot: P28349|NIT4_NEUCR

Sequence:
>Contig4546
TTGGACTTCGCCTGGCACTACCCCTATTTTACAACTCTAAGCAAAGATCT
ATTCTACAAAGAGTTTCTCCAGGGGAAGAATCAATCCCGACCATCCGGTA
TAAAATACTGCACTTCACTCCTAGTGAATGCGATTCTAACCCTCGGTTGC
CACTTTACGTGTGTTGTTGGATCTCGGGCGAACCACAATGACCCGGCTAC
AGCTGGAGATCACTTTTTCAAGGAAGCAAAGAGGATGATTCTTGAAAACG
ATGAGCACGAGGTTCCCCGGTTAACAACGGTACAGGCGCTAGCTCTGATG
AGTGTTCGCGAGGCTGGTTGCGGAAGAGAGGCGAGGGGCTGGGTATACTC
TGGGATGAGCTTTCGGATGGCGATGGATCTTGGGTTGCATCTTGACCCCA
GTTCCTTGAAGGACGGGGTGGGTTTGGGATCGGGGATAAGCGACGAGGAG
CTTGATGCTAGAAGGGTTACGTTCTGGGGGTGTTATCTGTTTGACAAATG
CTGGAGCAATTACATGGGTCGTATGCCACAACTCCCATCGTCAATGGTTA
CTGTGCCAAAACCGGACGTATTCCCAAGTGAAGATTCGGACAATTGGCTT
CCGTACACCGATTCGGGGGTCTCAACGATTAATCCGCAGCCCTCCCGGAT
CAGGGCGGTATCTTTACGGATATCAATGTTGTGTGAAATCAGCAACGACG
TGCTCTTGAGCTTCTACGATTCAGCCCCTGGTTCGAATAGTGGCGTGGTG
GAATTCGCCGCAACGACAATCAACCGTATTCAACAAGCGGGGAAGAATGG
GGTCCAGGCTGAATTTAAGAAGCTCGGCGAGCTTTTTGCGAGATTGGAAG
ATTGGCGGAAGAAGCTTCCGACTGAACTTGAAGCTAAGGAAGGCAGCCTT
CCGAGCGTACTTCTAATGCACATGTTCCACCAAACATTGTACATTCACCT
TTTCCGGCCGTTCCTGAAGTCATCTGCAGCGACGAATAGCACACTTTCCC
ATTTGGACCCCCGGAAGGCATGTCTTGCCGCAGCAACAATGATTTCGAAA
TATCTACGCTTTTACAAACGCCGATATGGTCTCCGGCAAATTTGTAATGT
CGCTGGGTACTTTATCCACTCAGCTTGTACCGTACACCTTCTCAACCTTC
AACAAAAGGCTGCCAAGCGGGATATCGTGCAGGGTCTGAAAAGCCTCGAG
GAGATTGGAGAATGCTGGCTCGTTGCAAAGAGAGCGCTGGTTATTGTGGG
GGTATTCGTCAAGCGGCGAGGAATCGAGCTACCAGAAGAAGCAGAGGGTG
TTCTGAAACGGTGCTGGAAGGAAGGGAAACGCTTCGGTCTCGGTGCCCAG
GTTGACAAAGTCCTCAGAGCCGCAACCACCATCAAACAAGGTCTTGAAGA
TCCAACGCCGCTGCCAAAGCCAGTAACGACAGCGCCAATTACTAGCACCA
GTGTATCTGACTTAACCCAAGCTGCTCAGCTCACATCTTTACCCTCCCGC
CCCCACCCATCAGCTTCCCCGCCCCTGCCGCACCGCAAATCATTCCCAGC
ACAATCCCCGCCTCTGCCGCCTCCACCGCCAATTCCCCAATCATCGCCCC
AAGCCTTCCCGACCCGTTACTACCCCGACCATCCACAACTCACGTACTAC
ACCTCCCCACCCTCGAACCCGCAATACCTTCCTACGACCGCCCCGTTATC
CCCTAGCAGCTGTGCTTCCGCCGGGACCCCGGGGAGTGAACTCTTGCCGG
AATTCGGCATTGACCAGGGGCTTTTGGACCAGTGCGAGAACTGGTGGTGG
CGGGATACTACCGAACTTGCGAATGAGATGGCGGTTGACACGCCGGCTTG
GCCTGGGGCTGGTGGGTCGGGCGCGGCGGTGCAGGGGACGGTGGGAGGGT
TTGGCGGGCCGGGGGCAGGAGGGTTTGACGACGGGGAGGAGTGAAGCGCG
AAGGAACGGAGAGAAGTAGGCAGTTGCGTTTCATATCCCAAAGGAGTGGG
GAGGGAAAAGAGAGGGAAAGGGCGAGGGAGCAAAGGTGGTCATGCTGAGT
GTACTGGATCTTGTGGTTTTGTATTGTGTTAGATGAAACTTTTTTGCTTA
ATGTCGATAAGTGTATTCTCAGCTTATTTATTCACGACGTGTCTAGCGTT
TTTAATATTTTCTTCC

Sequences in the Contig:

SY0AAA19YH14FM1 SY0AAA20YJ17FM1 SY0AAA26YH09RM1
SY0AAA31YA16FM1 SY0AAA41YB03FM1 SY0AAA41YG14FM1
SY0AAA46YD20FM1 SY0AAA5YC11FM1 SY0AAB12YO14FM1
SY0AAB17YM16FM1 SY0AAB20YC21FM1 SY0AAB20YE14FM1
SY0AAB33YF22FM1 SY0AAB35YJ01FM1 SY0AAB37YJ06FM1
SY0AAB3YO18FM1 SY0AAB41YC21FM1 SY0AAB48YI16FM1
SY0AAB58YD18FM1 SY0AAB58YE11FM1 SY0AAC14YN06FM1
SY0AAC21YB04FM1 SY0AAC21YB04RM1 SY0AAC24YJ24FM1
SY0AAC35YD03FM1 SY0AAC36YE13FM1 SY0AAC40YE19FM1
SY0AAC44YP20FM1 SY0AAD35YJ11FM1 SY0AAD56YO02FM1