Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4545
Length(NT) : 1595
Best Gene Model Blast : Link to GSTUMT00009504001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein AN6351.2
Accession: ref|XP_663955.1| Score: 1352 E_value: 1e-147
KEGG Definition: hypothetical protein
Accession: ani:AN6351.2 Score: 1352 E_value: 1e-147
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG2273 Score: 245 E_value: 2e-21
PFAM Definition: PX, PX domain. PX domains bind to phosphoinositides..
Pfam Number: pfam00787 Score: 205 E_value: 8e-17
Swissprot: Q5AZC9|SNX41_EMENI
Gene Ontology:
GO:0010008 = Cellular component: endosome membrane

Sequence:
>Contig4545
TTGGAGCAAACTCTTCTGGAATATAGAGACCCCCCAATTGCCATCACCGA
TGCGGGGAAGAATTCTGAGGGTAGTGGCGGTTTTATTGTATACACCATCA
GAACGGGGGATTTAGAAGTCCGCCGCCGATACTCTGAATTTGAATCGCTC
CGTAGAAACCTTTCCTTACTCCATCCTTGCCTTATCGTTCCTCCCATTCC
GGAAAAACACCAGGTCTCCGACTACGTTGCGGCTCCTACCAGTGCGAAGG
AGAATGTCAACATCATTGATCACCGGAAGCGAATGTTGGGTGTGTTCTTG
AATAGATGCGCTAGGATGCGTAAAATTCGGGAAGACAGTGTATTTCAACG
GTTTCTGGACCCTAATGCGAGCTGGAGCGAAGTACTGCATTCAGCGCCAA
TTTCAAATTTGCCGAAACAACATCTCAGGGCTCCTCCCCTTAACCCTTCC
AGTCCATCACCGGCTCATCAATTTTTACCTCTTCCATCGGCTTCTGCAAA
GCTCAAAAATACTTCTATCTCTCCTCCTTCATCGTCCTACGGTAATTCTA
GATCACGGGGTCATCCCCGTTTCCCACCTCTCAACCACACGCTTTCCGAA
TCTGAACTAGACCCTTATTTTAACAGCTACGAATCATCTACGCGGGTTTA
CGAGAGCTTGCTCACAGGTTCTATCGAGCGTGTAAACCGTAGAATCTTGA
AACGGTTATCTGAGCTCTCCATTGATTACCACGAATTGGGTGCTAGGTAT
AATGCGTTCTCGTTGTCAGAGTCTGGGGATCTTGCGTCTGCGATTGAAAA
AATAGGGCAGGCTGTCGATAGCTCCTATATAGCTACAGAGGGGTTGGCTC
TAGTTCTTGGATCTGGATTCGCAGAGCCTTTGCGTGAATCTGCTCAGTTC
GCTGGGGTAGTGCAAAAGGTCCTTCGTTACCGGGTTCTGAAGCGCGTTCA
GGAGGAAATAACAAGAGATCTATTGCACCAAAAGCGGACACTACTTCAAG
GACTTGAAAGATCGGAGATGGAAGCCAGGAGAATTGAGCAATACCTTCAC
GGTGGATCAGGCTTTGAGGGCTCTAGTGCTGGGAGTGTAGAGCCGTCTGC
GAGGGCTGATGACGTGGAATCAATTGACTCCGGAGATTTCCCCCCAACAC
ATAGTGACACCTCGCCGCCGCAACGCTCCAAGTCGATAACCCAACGTTCA
GTGTCTTCATCGTCACGTGGTGGTGAGTCACAAGGGCACCGAAAATCTCA
ATCCTATTCGCCACCAACAGCTGCTGGGAGCAGCGGCGGGGGTTTTTTAG
CAAAGGGTTTTGGAAAACTAAATTATGCTATCCATGGAATCGTCGATGTT
GATCCTGAGAGAACTAGAAGAGACAACATTGGTAAAACACGGGAACAACT
TCAGCAATTAGAAGCGGCAATTGAGGCTGCTGAGAAGGATGTCAAGGATG
CGAGCAAAGGCGTGTTAAAGGATTTGAGGCGATTCCAGAAAGGCAAGGAG
GAGGACTTGAAGAAAATGATGATCGTCTACGCTAAGTGCCATATCGAGTG
GGCTAAGAAGAACTTGGAGGGGTGGGAAGAAGCTAAGGAGGAGGT

Sequences in the Contig:

SY0AAC10YL03FM1 SY0AAC13YG23FM1 SY0AAC35YC19FM1
SY0AAD19YP12FM1 SY0AAD23YD08FM1