Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4544
Length(NT) : 1210
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 7

Blast Results:

Nr Definition: glutamate decarboxylase, putative
Accession: ref|XP_001263347.1| Score: 600 E_value: 4e-60
KEGG Definition: glutamate decarboxylase, putative [EC:4.1.1.15]; K01580 glutamate decarboxylase
Accession: afm:AFUA_3G11120 Score: 599 E_value: 3e-60
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG0629 Score: 430 E_value: 5e-43
PFAM Definition: Pyridoxal_deC, Pyridoxal-dependent decarboxylase conserved domain..
Pfam Number: pfam00282 Score: 361 E_value: 6e-35
Swissprot: P14748|DCE1_FELCA
Gene Ontology:
GO:0004351 = Molecular function: glutamate decarboxylase activity

Sequence:
>Contig4544
TTGGGTTTTGACTCGACACCACGAGCACTTCGTCCACTCACTGCACTACA
CTGTACTGTACGAGTACTGTACGAGTACTGTATCAAAGGCAGAGATATCC
AGTGCCTTCCTTTAGTCGAAAACCTTCATAATATTATTATTATTATATAT
TTTTACTCCCATCACATACGTCGCTATGTCATTGCCGTCTCAGAAATCCT
CGCAGATGAAAGCTTGCGAAGTAGAAAGACTCCTGAAACTCGCGCAGTCT
CATCTCCTTCCGCACATTTCATCCGCAGATGATATCCTGATATCAGATTA
CCTTCCACCACAAAGACTCAAAGAGGAACTTGGACTAGAGCTACCCACGC
AAGGGCGTGGAGAGAAGGGCCTAGAAGAGATTCTAAAGAGGGTCCTCAAG
TATTCGGTCAACACATGGAGCCCTGGCTTCATGGATAAGCTTTACGCGTC
CACGGACGCCGTGGGGGTTGTTAGCGAAGTCTTGCTAGCAGTCTTGAACA
CCAATGTATTCCCCTCCCCTTCCCCATCTCCTCGGCCTACCCACTATGGG
TTTGGAGTCACTTCCAAGTGGAAATCTTAGAGGATACAATGCTCATGAAT
TGTTTGGGATGACGTTTTGATAGGTTCATGTGTACCAAGGTTTCAACATC
CTCTCCATCTAGCCATTAAATTATTAGCAAAATTAACAAAAAAAAACAAA
CAGTCTCTCCGGCCCTCACCATAATCGAGAAAGAAACTTCCTCCTCGATC
GCTCGTCTTTTTGGGTTTACCTCAGGGCACGCCGGAGGTCTAACATTCCC
GGGTGGCTCGGCATCCAATTCCACTTCGATGATTATAGCAAAGAATACCC
TCTTCCCTGAGACCAAAGTTTCTGGCAACACTGGGTATAAGTTCGTAGTT
TTCACTAGTGAGCACGGCCACTACTCTGTCGAGAAAGCTGCGATATTACT
CGGCCTCGGGAGTGCTGCCGTACGGAGTATCCCGGTTGACAAGGAGGGGC
GAATGGTTGTTCCTGAATTGGAATCCGCGGTGCGAAAAGCCAAGCAGGAA
GGCTACACCCCCTTCTACGTCAATGCCGGTGCAGGCGCAACAGTCATGGG
CTCATATGACCCATTCAATGCTATTGCGGATGTCTGTCAGAGATACAACC
TATGGATGCACGTCGACGGGTCGTGGGGTGGGTCAGTCGTCTTCTCAGAT
AAACACTGTT

Sequences in the Contig:

SY0AAA39YK17FM1 SY0AAB5YJ05FM1 SY0AAC11YP08FM1
SY0AAC35YC16FM1 SY0AAD23YC08FM1 SY0AAD31YC14FM1
SY0AAD55YP20FM1