Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4543
Length(NT) : 743
Best Gene Model Blast : Link to GSTUMT00011680001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: ORF140
Accession: ref|YP_001096175.1| Score: 318 E_value: 2e-36
KEGG Definition: thymidylate kinase [EC:2.7.4.9]; K00943 dTMP kinase
Accession: cne:CNC04630 Score: 315 E_value: 5e-36
KOG Definition:
Classification: [Nucleotide transport and metabolism].
Kog Number: KOG3327 Score: 489 E_value: 4e-50
PFAM Definition: Thymidylate_kin, Thymidylate kinase..
Pfam Number: pfam02223 Score: 337 E_value: 2e-32
Swissprot: P36590|KTHY_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0005634 = Cellular component: nucleus
GO:0004798 = Molecular function: thymidylate kinase activity
GO:0006235 = Biological process: dTTP biosynthetic process

Sequence:
>Contig4543
TTGGGTCCTAAAGTGCTCGTACGATATCATACATAACCAAGCTGTGCCAG
AACCAACTTGCACCAACCTGCCGGCTCAGCAATGTCATCCTCAGCGCCCA
AAACGCGCGGAGCACTGATAGCCATAGAGGGGCTTGACCGAGCCGGAAAA
TCCACTCAATGCCAGCTCCTAATGGACCGCCTAGCAGAAAGGAACGTACC
CGCCCGTCTACAAAAATTCCCCGGTACAGCATTTCTTCCCTCCCTCTCCT
CCCCCCTCCTGGCAAGCTAACCTAACTAACACACAAGACCGCACAACCCC
CATCGGAAAAATGATAAATGCCTACCTCTCCACCTCAACCACCCTGGAAG
ACCACACAATCCACCTCCTCTTCTCCGCCAACCGCTGGGAACTCTCCGCG
CACATCCTGAAACTCCTGAACGACGGCGTTACCATTGTGTTGGATAGATA
CGTATACTCCGGGATCGTCTTCAGCGCCGCGAAAGGTCTCAGCCTGGACT
ACTGCCGCGCGCCGGACGTGGGCTTGCCAAGGGCGGACGTAGTCTTGTTC
TTGGATCTGGATGCGGAGGTGGCGAGGCGGCGGGGCGGGTTCGGCGGTGA
GCGGTATGAGGTTGAGGCGGTGCAGAGGAGAGTTAGAGATTTGTTTAAGG
AGGTTGGAGAAAAAGAGGAGGGGAGGTGGAGGGTTGTGGATGCTGGGCGC
AGTGTGGAGGAGGTCAGAGAGGTGGTTTGGGGGGTTGTAGAAA

Sequences in the Contig:

SY0AAC15YF17FM1 SY0AAC35YC04FM1 SY0AAD6YP22FM1