Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4541
Length(NT) : 884
Best Gene Model Blast : Link to GSTUMT00004967001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein SS1G_03522
Accession: ref|XP_001595433.1| Score: 705 E_value: 2e-72
KEGG Definition: hypothetical protein
Accession: ncr:NCU00681.1 Score: 621 E_value: 5e-63
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG4347 Score: 218 E_value: 1e-18
PFAM Definition: No Hit Found
Swissprot: P53258|GYP2_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005625 = Cellular component: soluble fraction
GO:0042802 = Molecular function: identical protein binding
GO:0005097 = Molecular function: Rab GTPase activator activity
GO:0006886 = Biological process: intracellular protein transport

Sequence:
>Contig4541
TTGGAGGAATTAATGGTTGTGGCGTTCAAGGAGTTCGCAGGAATTACACA
GAACACAATAATCGAGCAAAGGAACAAGCATAAAGATGCAGTCTTATCCT
CGATAGAGAGCTTCGCAAAGAGAACCCAATTAAGAAATCTTGGTCCTGAT
AGTAGGCGCCTGACTCCCGAGGAATTGAGTTGCGTTTACGACCGGTATTT
TGGGGTTTTGTACGAGCGCCAAGGAAGATTACAAATGATTGCGGACGAAA
TGGAGAAATTAGCCACAAAAAAGAAAGCTGCTGCGGGAAGTGGTGTAGGT
GGAAACGGGGGCGAAAGAGGAAGGGTGGGGTTGGGGCCAACCACTGGGGA
AACGGGAATGGATTACGATTGTTTCAGAGAGTTTCTAACCGGAATCGCCA
AGTGGGCTGTTGCTGGCTCGGCCGTGAACACTCCAGCCGAGCCTACACAA
CCGGAGCAATCTGGGTTTTTTGGTTCATATGGAGGTACTACTACTGCTCT
ACAGCGCAAAAATCTGCTCAACCCTTGGGGAGCGGGGAACCCCGAACCCG
CCGATCACGAGTTCATGAAACGACTGTTCCGGCGCTGGGATACAGACATG
AAGAACCAACTGAGTCTTGGAAACGTTGTCAGCGGTCTGGCGAGTGTTGT
TGGCGGAAAGAAGGATATTATGGGCAATATTAATTACTGGTTTGAGCTTT
ATGATGACGACGGAGACGGGAAAGTCGACAGAGAGGGTATCTTAAGGATT
ACTGAAGCTCTTCTATTCGTTACAAGACGCGGTGATGTGGGCGGGGGTGA
CGGTGAGGAAGCAGAGTGGGGAGACGAGAGGATTTTGAGCGCAGTCAGCG
GATTCACTAGAATGTGCTTTGAGTACGCGGACCC

Sequences in the Contig:

SY0AAB36YH19FM1 SY0AAC34YP18FM1 SY0AAC43YH20FM1
SY0AAD21YC05FM1