Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4540
Length(NT) : 699
Best Gene Model Blast : Link to GSTUMT00004391001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001211836.1| Score: 595 E_value: 6e-60
KEGG Definition: predicted flavoprotein involved in K+ transport
Accession: aor:AO090001000564 Score: 591 E_value: 9e-60
KOG Definition:
Classification: [Secondary metabolites biosynthesis, transport and catabolism].
Kog Number: KOG1399 Score: 165 E_value: 1e-12
PFAM Definition: FMO-like, Flavin-binding monooxygenase-like. This family includes FMO proteins and cyclohexanone monooxygenase..
Pfam Number: pfam00743 Score: 151 E_value: 6e-11
Swissprot: Q00730|STCW_EMENI

Sequence:
>Contig4540
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCTTCATATCGAAGTCTTCAT
TTGCGAGCCTCACTATCTCTCCATAATGGCCCCACCTCATGTCGATGATC
AGTACTCTGCGGGCTCCACCTACCCACCAAACTGGATTCCAGTTGTGGAG
AAACCCCTACGCACCCCGAAACGAGTGAGAATTATTACTGTAGGTGCTGG
GCATTCCGGATTAATGCTTACGTACAAGATTAGAAACCAGTTCAAGTACG
GGGACTTTATGGACCACATTATCTATGAGAAAAACCATGATATTGGCGGA
ACGTGGCTTGAGAACAGATACCCAGGGGTTGCCTGTGATGTTCCTGCTCA
TATATACACCTTCTCATGGGAGCCAAATCCGGACTGGAGCGAGTTTTACG
TTGGCGGAGAAGAAATTTTCCAATACATGAAGCGTACAACGGCGAAATAC
GACCTTGCAAGAGATGTTGTTTTCAATTCCAAGGTTGTGGAAGCCATCTG
GGACCAGGGGCGAGGTAAATGGGAGCTCAAGATTGAGCAAGAGGGACGAT
TTATCTGGGACGAATGCGATATCTTTATAAACGCCTCAGGGATCCTGAAT
AAATGGAAGTTACCATCCATTGAAGGAATAAACGCTTTCAAGGGACACTT
GGTGCATAGTGCGAAATGGGAGGATACTTACGACTTTGCTGGAAAGAGA

Sequences in the Contig:

SY0AAC34YP12FM1 SY0AAD45YA13FM1 SY0AAD45YJ04FM1
SY0AAD63YK16FM1