Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig454
Length(NT) : 735
Best Gene Model Blast : Link to GSTUMT00011287001 E-value : 7e-68
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig454
ATTTTTCCCTAGCTTTTGTTCGGTGTCTGGACGATTATGACTGTAGCATG
CCATGAATCACCTGGGTTCCCGAGGCGGGAGAAGAGGTCCTTGACGAATT
TACATGATTTTCTGGAAACGCAGAGGGGGCAGTTTATGAGGGTGGGTTGG
AAGAGAAGTGAAGTGTGCTCGCAAACCGGTGGGGGTGAATTTTGTCTTTC
CATTTTTTTCTTCTTTCTCTTTTTCTCAACTCTTTTTACTTTTTGCTTTC
TACTTTCCTTTTACTTTTCCTTTCTTTTCTTTCTCAAGCGTTATCGTCGG
TGGGCAGAAGCAAGGTACGCCATTGTGTATCAATACGGAAAATAAGCAAA
AATACGTACAATATGTATTTTGACGATGGGCCAGGTTGAAGATAATAGGG
GGCACACGAGGAGTTGGCATCTTTGTTTCTTTTCTTTTTCTTTTTCCTCG
TCTCCTGTATTTTTTTCTTTTTTCCTCTTCCCCCTCTATATTCATATTCA
TTCCTATTCGTACTCGTATTCTCATCTAGGCTCTGGCTTCTGGTGTTGGT
TCTTTCTTGTCTTGTCACCATTTCTTAATTTATGGGAGGTTTTTTTTTCC
CCTTTGCCTGTTCTTGATTCCACACAATAAGTTTCTGCTTTCGGTTCCAA
AGTTTTCTCTGCTTCATTTGGGGGATAGGGATGGACTGCATTACGTTTGC
TCTCTCCCCATCCCTCTTGTCTCGTCTTGTCTGAC

Sequences in the Contig:

SY0AAA24YF19RM1 SY0AAB21YB22FM1 SY0AAD36YP10FM1