Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4539
Length(NT) : 3014
Best Gene Model Blast : Link to GSTUMT00008987001 E-value : 0.0
Numbers of ESTs : 17

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4539
TCTATCCTCGCGCGGGATATTGGTCTAAGGGAGAAAAAGAGAAAAGAGAA
AAGCGTTCCGCCAATTTCTAGGACTTTTATTGATTCAAAGGTAGAAAAAC
ACGAACACCAGATGTAGCTTTAAGTACCCCGAGAAACTTAACCACCAGCC
CCTGCAACAAACTCCAAGCGTCCCCCTCTATGTGCGATGCCAGTCCCAGG
GTAAAGAAATATCTATCTAGAGATTACAGCCTCAAGCACTCGTCCCAGCC
ATAACCCACCCAGGCCAACACATGAGGTTGCCTCCCATCCCAAGTGTCTA
AAGGGACATGGCATGCCATAGTCAACTTACCGGGGTGGGCATCGACTTAG
ATGTCATCTTCCCCTCTCTCCAGGCGCCGGCCTCCGCCATGCAGGTGGAC
TTCCCACGGCAAAATATTATCGTATCGTCGCTGTCTTTCCTCCTGGGCGA
AACGGTCCATGTATCGTGCTAGTATATGCTCAAATTGCCCACGTTCGTGA
CGACGTTCATGCTCACGATTTGGATCCCGTTGCGCTCTACGAGGGTCATT
GTTATTACCAACAGTTTTCACTTCGACAACGACCTGGTCTCGTTTTCTAA
GGCTTTGCATCTCCCAGGGCTGTGTTCTGGATTTCACGCTGGTGCTTGCC
GAGGAGACTAGATCTATGAGGGCGCTAGGTCTCACAGAGAGGAAAATAGA
ATTATCGGAGCTTTTTCCCATGGTCGCGAAGTAGTCGCGAAGCTGTCTCT
CCCTTTTGCGCTTCCTATGCTGGTACTCGCTATGTTGATTTTTTAAGTAT
TCCCAAAGGTCCCGGTCCATGCCCGGGCAGCTGCGCTGAATACCCAAGCG
AGGGTCGGCGCCGTCATCAACTCGAGACTTGGGAAACGCCACCTCGAACC
CAGAGAGAACAATAAACATAAAATCTTGTATCATCTGTCTTGATCTCAGC
CTGTGGCCGATTGTGAGAAATCTCACTGCTTCAGGTATAGTCGCGTTGTG
TCTGAAGAAGCTTCGGCGGTCCATATATGCAGCCTCTAGGAAATTTGAAA
TAGGCCTGATGCCGCTCCGGAGACAGCCAACTGATATGCCTATGTTGACC
AGAGCTTCGATAAGATCTTGGAACTTGCGAATGGGAAAGGGAACCCCCCT
TTGGGGGGACAACTTTGTACAAAAAAGTTGGGGGGACAACTTTGTACAAA
AAAGTTGGCCAAGCTCAAGCGAATACTTTGGTGAGGATGGCTCCATAGAT
GGAAATTCACGAAGTCGTCAAAGCTCCGTGAGTTTGCCGAGGCGACCCTC
GCCCGGCTTCCGCCTCCACGACACTATGGGCTTTGAGAGTATGGCGGATA
AACCAATCAACCGTCACTCCTGGAACTCAAGGCATTCTGTTGGGCCCAGT
TACCGTTCGCATTCCCCGGCCCCACCAGTTCCTCCCATTCCCGGGTCAAC
AACTCCCACCTCTGGTACCATGTCAAGACGGAGTACCTTAAACCGGAGGT
CAGAGGACTACACAATGGACCTTTCAGTGAGCCCAAGACTCAGTTCTGAA
TCTAACAGTAGTCAAGACTGGCATAATCTACAAACAAACCGCTCGTCACC
GGACCCTGAATTCGATCATAGACGTGAGCTTCCCGCCACAGTTGATCGAA
GTGTGTCTGGGAAACGACGTTCAGAATCTCAACGGAGTCTCCACAGAGTT
GCTGTCAACAGGAGACAGAGCATTCGTCTGGAAAACGAGGACGAATCTGG
AGCCATTGCTTCCAGCATTAAGAGGCGCGATAGCATGGGATCTGATTTCG
AAGTTGAACCATCTGATGAACAGGTTCGGCATGCAACACAGATTTGGAGC
GAGCGCAGAAGATACGAAAATGCGGATGTCCAGTGGGCTCGTGACATTCT
CAGGAGGCACAAGAGCTGGAGGAATACAAACAGCAAATATCCTAACCCCC
TCCAAGCGAATAGGGGAAGCGTCGAACAGTTTCAAACACGGCAGGACAAT
GCTGGTGAAGGATCTAGCTCCAGCGCCAACCATCACCCTCAGCAGCCATA
CCCATTAACTATACCAGTGTTTTCGGGTTCTACCCCAGGGTTTATGGGAA
ATAACATCCCCACCCCTGTGGAGGAGGAGCCAGATTCTGCTGGGCTCAGA
GGTGGAACCGCTGCCAACAGGTCTTCACGGGAACTCGAAATACGGTTTGG
AAGAGACCCAGAGCCTTCGGAGTTTTCACCCGCCGGCACTCCCCAGGCCG
GCAACATCCAAGCGCAACTTGATGATTTCGGTGGCCTCGCTCCTCCTAAT
GGCAGCGGTGCGCCGCGTCAAGAGGCTGCCCCGTCAGATATGCCCAGACC
CCAGCTAAACCCTCGCTATGCAGTCCGAAGGTTGAGGCGACGCTGCAGGA
AGGCGCTGAAGGCCTTTGCGCGCAAGATATCATTATTCCGCCGTATTTCG
AACAGCTCAGCACCCCAGGCACCACCTGGCAGCCGTAGCTGCCGCTGTTG
ATCACCCTCAACAGGACTCCGGTATATTCCCAAGTTCTCCGGAACTGCCG
GAGAACTTGGGGCCCACATCCACCAGCCAGGACTTGGAGATGCACGAAGC
GCCACCTGATGACCCTGCTGAAGCGGAGGCCAGCACGCAGGTTTACTCGG
GGGAGATCACTCATGACCCTTCTGAGGAAGAGGTCAACCGGGTTGTCGGT
GAGATAGCCCATACCATCAATGGTATGGTCGCCCCGTTAATAGAGCTGGA
ATTCGAAGCAACACCTCTACAGCTAGGGTTCGCTCCCCGGCAAGTATCAA
TGTAAGGGACAAGTTATGTTTTCCTATATTTCCTCTAGTTTTGGGGTGTT
TTTTTCACCCCCTTTTTTTCTTTCTCCTTCGTTCTTGCTATTATTTCATG
GTAAATTTTTATATACCTTCGGAACAGTTACAAAATAGGTCCAATCTTGT
TGGTGTATGCGTTGGAAACGTATAGGTACCCGATGCACTTAATTTGTAAT
GATAATAAAAAGAG

Sequences in the Contig:

SY0AAA11YC05FM1 SY0AAA15YI18FM1 SY0AAA16YM13FM1
SY0AAA19YC01RM1 SY0AAA22YJ01FM1 SY0AAA36YA22FM1
SY0AAA60YJ17FM1 SY0AAB31YB16FM1 SY0AAB32YH01FM1
SY0AAB57YJ19FM1 SY0AAB6YG02FM1 SY0AAC28YP08RM1
SY0AAC34YP11FM1 SY0AAD13YE06FM1 SY0AAD15YG03FM1
SY0AAD2YB02FM1 SY0AAD58YO08FM1