Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4537
Length(NT) : 528
Best Gene Model Blast : Link to GSTUMT00007779001 E-value : 1e-133
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein FG06945.1
Accession: ref|XP_387121.1| Score: 304 E_value: 2e-26
KEGG Definition: hypothetical protein
Accession: fgr:FG06945.1 Score: 304 E_value: 9e-27
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4537
TTGGGGAATCCAATGATAGAATGACCCGTGATGTGGAAGATAGTGTTACT
GAGTTCCGGAAATCACTGGAAGGTTCTCTCAAATTTGCTCCTGGTGAGAG
CGGTGGTATCTCAGATTCCGAGAGGAGAAGATGGGAAGAGGCTTTGGGTG
TTGAGGATGAAGTCAAGGAATTCATTTTTGACCTCCAACGCCAGTCTCAC
TCCGCTAAGTTGAGACGGGAAGATGATAGGGATTATCGCCGCCGTGATGA
TCGCTCCAGTTCTAACGCATCAAGGCCTGTTGAGGAGCTGCCTCGCCGGA
CCGCATCTCCAGCTCTTGCGCCCCCCTCACGCACCTCCACACCATCTGGT
TCTTCTTACTCAAGCTTCAAGTCTGCCGAAGAGCGAGCGGCTTTCATTAA
GCAACAAGCCGAGCAGAAGATGGCCGAGCGTCTAGCCGCGCTTGGGATCA
AGCCACCAGCGCGCTCGAACATTGGCGAAACTGCCCAACAGCGTGCAGAG
CGCGAGAGAAAGGAGAGGGAGGAACGCC

Sequences in the Contig:

SY0AAB32YD04FM1 SY0AAC34YP01FM1