Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4536
Length(NT) : 670
Best Gene Model Blast : Link to GSTUMT00009087001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein An17g01310
Accession: ref|XP_001398360.1| Score: 418 E_value: 2e-39
KEGG Definition: hypothetical protein
Accession: ang:An17g01310 Score: 418 E_value: 1e-39
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG4173 Score: 226 E_value: 9e-20
PFAM Definition: No Hit Found
Swissprot: Q8NB15|ZN511_HUMAN

Sequence:
>Contig4536
TTGGCCCAAACCATCTTTTGTTCGCACAACTCGGCCCATCTTCATGGCTA
AAAGAGTCCGCTCGGATTCCGTCAGTTCAGCTACGTCGCCATCCTGGACA
ATATTCACCCGTCCGGTTGATCAGGAAGACACGGTCAGCCAAGACCTATC
CTCTAAATCTAGCTACTCCAAGCATGTCTGTCTCGATCCGCTTAGCAGTG
AGCAGACACCTTCAATCAGCTGTTTTCTTCCACCAGGTTGCTCAGGGGAA
CCCTTCGCTTCTCACGAACAGTTTGAAACCCATTACATTCAAGCTCATTC
AAACCGCTGTCATGAATGCGGTCGGAATTTTCCGTCTCTGAGGTTTTTGG
ATCTGCATATCGCTGAGAACCATGATCCACTAACGGAGCTTAAGCGTGAG
CGTGGTGACAAGACCTATGCGTGCTTTGTAGAAGGGTGTAGTAGGTTATG
TAGCTCCCCGCAAAAGAGACGAATGCATTTGATCGATAAACATCATTTCC
CAAAGGAATACAACTGGAATATCGTTAAATGGGGCATAGACCAATGCACT
TCCCTTCTTTCTCGAAAACGCTCGCTACCTCAAACCTTCACAGAAGGGGA
AACTCTGACTGCTGGAGGGAGGGATAGGTTTCGTTCTGCCAATGTCCATA
AGGGGGAGACGAAAAGGCCG

Sequences in the Contig:

SY0AAA49YP13FM1 SY0AAC34YO20FM1 SY0AAC8YK11FM1
SY0AAD21YC17FM1