Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4535
Length(NT) : 1358
Best Gene Model Blast : Link to GSTUMT00005212001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: membrane biogenesis protein Yop1
Accession: ref|XP_001536604.1| Score: 607 E_value: 8e-61
KEGG Definition: hypothetical protein
Accession: ang:An17g01420 Score: 607 E_value: 4e-61
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG1725 Score: 357 E_value: 2e-34
PFAM Definition: TB2_DP1_HVA22, TB2/DP1, HVA22 family. This family includes members from a wide variety of eukaryotes. It includes the TB2/DP1 (deleted in polyposis) protein, which in humans is deleted in severe forms of familial adenomatous polyposis, an autosomal dominant oncological inherited disease. The family also includes the plant protein of known similarity to TB2/DP1, the HVA22 abscisic acid-induced protein, which is thought to be a regulatory protein..
Pfam Number: pfam03134 Score: 284 E_value: 4e-26
Swissprot: Q5BB01|YOP1_EMENI

Sequence:
>Contig4535
TTGGCGCCTAGGGCATTCAGACCGGATCCTCCCCATTCCATTCTCTCTGC
CTTTCCTTTCTATCCCGGACCAAGCTACCATATTCCCTTATCCAAGTTAG
AAGGGGACCGTCACCTCTCCACTGTACTTAGCCTACTCTACGAGTACCGG
TACTGCCTTTACTGCCCACAATAACTTTTTTGCACCCTCAGCATCATCAG
AGCCGTCCCTCCCCGATATCGCCCACCCATCCATCTTCTCTCCTCTTTCC
TCTTCCTCTTCCTTCTTCCCACTTAAATCTCACAGCTCTCCCTTTCCTTC
CTTTATCTCTCTCCTCTTCCCGATTCTTCTCATCTCCCTCCATTCTCATT
ATACGCGCTCCCGTTGGAACTTACCCTTCCGCTGAAGCCTAATTCTGCAA
CTTTACCGTTACCCATCATCCCCCACTCCTGTGTCTGGCTCCCCCTTCTT
ACGACAACCATATTCGACATGTCTTTCCAAGATAAGGCCCAAAATCTCGT
CTCTCAGCTCGATAAAGAGCTCTCGAAATACCCTGCTCTTAACAATCTCG
AGAAACAAACCGGTGCTCCTAAAGTATATGTTGTCCTCGGACTTGGATTC
GTATACTTTTTTATGATCTTCATCAACTATGGCGGCCAACTCTTGACAAA
TCTCGCCGGGTTCCTCATTCCCGGTTATTACTCACTCAACGCACTCTTCA
CCCTCACCAAGGTTGACGATACACAATGGCTTACTTACTGGGTTGTATTT
GCATTATTCAGTGTGATTGAGTCTGCTATCTCTGTTACCTACTGGCTACC
ATTCTATTACGTCTTCAAGTTTGCTTGTATAATGTGGCTTGGTCTCCCTC
AATTCGGTGGTGCTCAACTTATCTTCCGTTCATTCCTCCAGCCTATCTTT
GCCAAGCAATTTACTGGCCGTGCCAACGCTGCATCCTCTAACCTCCGTGC
AAAGGCTGATGTTATCTCTGCTGATAAGACGTTGTAAAAGGCCAAACGAT
ACGATGCTCACTCTAATGCAACGCAAGGCTGCCGGTATGACGCATGCGCA
CGAAGACACGATGGCCAGCCACTGGGTTTATATTTTTATTGGGTTTATTC
TCTTTTAGTCAAAAGTCAACGTAGGCAAAAATGGGATCAATGAGCGGTTA
ATGATCTTTTTTTCCTTTTTTTCCCCCTCGCTTCAAGGGTCTATTTCCTT
GGTATCTTATTTCTTTCTCTTCCTTTCTTTTCCTTCCCCACCCTCCCTTT
TTTTTTTTTTTTGTAGAGTCCGGCTTTGTTCTATAGTCTAGGGTTCCCTT
GGTTCCATTTGCGCGCTTGGCCCTTTTTTGTAGGGAGATAATGCAGCCGA
CTTCTTTG

Sequences in the Contig:

SY0AAA21YN03FM1 SY0AAA31YE22FM1 SY0AAA56YK03FM1
SY0AAA8YA16FM1 SY0AAB12YL15FM1 SY0AAB27YG23FM1
SY0AAB40YB14FM1 SY0AAB45YE09FM1 SY0AAC33YD01FM1
SY0AAC34YO19FM1 SY0AAD47YN23FM1