Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4534
Length(NT) : 663
Best Gene Model Blast : Link to GSTUMT00004107001 E-value : 1e-139
Numbers of ESTs : 5

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4534
TTGGCTTCTCAACCTCCTCTCTGAACTTAACACCGTATCTCCTCTCCCTT
TCTTAGTTCTACACACACATAACTCCAGAGGAGCAGAGGATCTTGACCTT
CCTTCGTTTCTCTTCCTAGATTCCAGTCCTTTTTCATCGTTCCTTTCTTT
GCGACGCTACGACATCCATAGGCAGGAGCGATCTGGAAGGAGGTGTTCTA
TACCAGCTTTTCTTCGCACCATTTTTTCCTTCTTTCAAAAGCAGACAGGA
GTCTCAGGAGTCCTTGTTTGTCCTTGAACAATACCTCGGTTTCTTTCATA
ATTCACAGATTGTTGTTTTCTCGGCTTCCTCTTCGACACCGAATTTCCAT
TCCATCAAACACATTCATTCGAGAATATTTACCGAAGTAATCAACATTAA
AAAAGATCTCCAATCATGGCTGAACTTAATCAACGCATGTCCAACCTGGG
CATAGGTGACTCGATCCATGCCACTGATGGGGTCCCGTCTTCTGGGACTT
CTAATCATTCTGCTGGGGGCGGTGGTCAGACGACCGCCTCTGCTTATATC
CCTCCCCATTTGAGAGGCGCTGCCAGATCCAACGCCGGCCCCTCGCCTAC
CGTGGCCCCTCCCGTCCAGAATGGCACAGCAAATGGCATTCAATCCTCCA
GATGGAGTAACGG

Sequences in the Contig:

SY0AAA54YF15FM1 SY0AAB60YE07FM1 SY0AAC34YO13FM1
SY0AAC46YB06FM1 SY0AAD26YI07FM1