Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4533
Length(NT) : 1435
Best Gene Model Blast : Link to GSTUMT00005410001 E-value : 0.0
Numbers of ESTs : 15

Blast Results:

Nr Definition: hypothetical protein SNOG_10555
Accession: ref|XP_001800823.1| Score: 283 E_value: 3e-23
KEGG Definition: hypothetical protein
Accession: ang:An08g05690 Score: 270 E_value: 5e-22
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q9VM65|CCA_DROME
Gene Ontology:
GO:0005515 = Molecular function: protein binding

Sequence:
>Contig4533
TTGGACAGCTCAACAAACGCTCAATCGAACGAACTTTGACCAGGAAATTC
TCTAGGGAAAAATCAGAATTAAAATTCATCTCATTCGTTGCTTGTTTGTT
TTTTCTTCTCATCTCTCTCTCCTTTGACAGTAACCTCCATCTACAAGCCT
CTACCAATCCAATAAGTTGATACGGGTACCTCCTCCTTCATCTTCTCCCT
CGCTCCTCCGCCTCGGATTTTCGTCGGAGAAGGAGCATCTCGTTTGAAAG
CGGGAACTACGGCACCGTGAATGTTGCCATCCAATTATCAAGATAGTAGC
CACAGCAATAGCAATACTCCGCTCTTCTCGAATAGTGGTATCAGCATTAC
CGGGCGTCGCGATAGTGCCAGTTTGCCTTCCAATCATCTGCTCCAGCAAC
AGCAGCAACAGCATCAGTTACAACAGGCAGGCATGGTCAACATGTTCCCC
ACCGCTGGGCACCAAATGGACCTTAATCATCTCTGGCAGCAGGTTCAGGA
GCTTAGCGCGATCCTGGCGCAGAACAGGGAGAGCACAGCTGGGTTAGTCA
GAAGGGCTGATGAGATTCGAAGTCGAACAAACTCAGGGGAGGCACTACCG
CATATACGAGAGTCCAACGGTGAAGCAAATGGCACCCACGATGTCGATTT
TGAAGCAGAAAACCGTGCGCTGCGTCAGGAAAACCACAATCTCCAAACAG
AAAACGAGGATCTTTCACTGCTGGTCCAGGACTATGAGGCGGTACTGGAC
AAGGTTTTAGAGGGTCTGAGAATCTACGCTCACGAGCACACTGTTTCCAC
AATCAATATCCATCAAACGTATACGAACCAGCTCGCAAGTGAACGACAAG
CGAACGCGGTCCTACGTCAGAACGAGACCGAGAGCCAGGCGCGATTAACA
AGGATCAGCAAGATGCTCAGGGAAGCATATGAGCAGGATACGGCTTTAGA
GCCGGATATTCTTATTGAAGGATTAAAGGTCGAGAACGAGGCCTTGAGAG
AGGCGCTTGGCCTACCTAAAGAGGAGGGGGAGGGGGAGATCAGCCCGGTG
TGACCGCGTAACTTAACGCGTTCGCGAAGGATCGCAGCGGAGGCTAGGGA
CAAGTGAGCAGAGATAGAGAAGCGGAAATATAGATTTGTTGAGAACAAGG
CAGGGTGGATGGCGAGGCTCACGCGTCCGTTTCTCTGACTGGATGGCCAG
TAGACAATGGCCTCTTGCATATCTTTTCTTTTTCGGTGGAGCAACTGGGA
ACCGGAAATCAAGTCATGATAGAAAACAAAAAATATGGGGGGTGGGTGGG
AAGGATCAATACCGTACGGTACTCGAGTAGGTTTTGCGAATTGGGGGAGA
CCACCGTAAAGTTAACGATAAACCTACTTTATAAACAAAACTAGCTACCG
GCACGGTACTGTAATAAATAAGTTCATTCAAACTT

Sequences in the Contig:

SY0AAA23YJ05FM1 SY0AAA7YB13FM1 SY0AAB40YO22FM1
SY0AAB53YJ11FM1 SY0AAC18YM24FM1 SY0AAC19YP16FM1
SY0AAC19YP16RM1 SY0AAC34YM22FM1 SY0AAC34YO07FM1
SY0AAC4YO13FM1 SY0AAD13YM19FM1 SY0AAD1YI10FM1
SY0AAD27YE20FM1 SY0AAD44YO11FM1 SY0AAD57YN01FM1