Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4532
Length(NT) : 3597
Best Gene Model Blast : Link to GSTUMT00000610001 E-value : 0.0
Numbers of ESTs : 36

Blast Results:

Nr Definition: hypothetical protein SS1G_09491
Accession: ref|XP_001589769.1| Score: 2800 E_value: 0.0
KEGG Definition: assimilatory sulfite reductase [EC:1.8.1.2]; K00380 sulfite reductase (NADPH) flavoprotein alpha-component
Accession: afm:AFUA_6G08920 Score: 2766 E_value: 0.0
KOG Definition:
Classification: [Energy production and conversion].
Kog Number: KOG1158 Score: 875 E_value: 5e-94
PFAM Definition: FAD_binding_1, FAD binding domain. This domain is found in sulfite reductase, NADPH cytochrome P450 reductase, Nitric oxide synthase and methionine synthase reductase..
Pfam Number: pfam00667 Score: 571 E_value: 7e-59
Swissprot: P39692|MET10_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0009337 = Cellular component: sulfite reductase complex (NADPH)
GO:0042493 = Biological process: response to drug
GO:0000103 = Biological process: sulfate assimilation

Sequence:
>Contig4532
TTGGAGCTAGCGTCCAATCCCTACTCATTTGCTACTACATCTCCCTCTTC
TCTCCCCCGTGCCTCTCCATTCTCCCTCCCCATCTCAAATCTTCCTACAA
TCCCCATTGCATCCTCAACTTCAGGAGCAATCACTGGCAGAGAAGATGGC
ACACCAAAGCGGAGTAAAAAACCCCCTCGAAGAGATATCACCGGTCTTCC
CCCATTCTGTTCCCGCAGATATCTCATCCGTGAACGGAACACTGTACACA
ACCGCCCAGACACTTGTCCAGCAAGTAGCATATACCCTCTCGGATAAGTT
GTTCACATACTCCCCCGACACCTTCTCGCTGGACGAAGCGGCGAGACTCT
GGAGTGGCAATGAGCAGACAAATGTGCGTGGGGTGGTCCCCACTGTTAAT
GCCATGGAAACAAGACTGGGCGCTGCGAATGTTCTCCTCGGATACGTGTT
CTCCCCCGACGTGGATCCGAAGAAGAAGGCTGTTGCGAAGTCAATAATTG
CGTCCTCTCCGGCGCTTATTCACATGCGCTCGGCATTGGACCAATTGAGC
GTTTTGTACGGCGTTTCTTCGCCGTTCGTCGCTCACGTTTCCGCCGTCGA
TTATGAAGTGTCTTCCGCGAAATTGGTCACAGACTATGCCTCTGCCGTTA
CCGTTGCGCAGGAGACCGGAATTGGCCTTTTGGCTTCGTTCTCCGCGCAT
GAGGCACAGCACATGGCGCTCTTCGCTACCCTTGCTGCTACTGTCCTCCC
GATGGTGCATATATACGATGGCGTCAGCGTGTCCCGGGAGTCCGCGAAGA
TCAAGGATGTTCTTGACCGGACCAGCTTGCAGAACGTCTTCTCTTCCATC
CTAGGGGAGCAGAAGGAGGCGCCGAAGAAGGCTGACCAGGGTACAAAGGT
CAATGCCATCTTGAGAGGTCTCAACGCGGAGCTTGGGACCGCTTATTCTT
TGTTCGAGTATGAGGGTCACGATGAACCTGATGCTGTGTTGGTCACTTTT
GGATCTGTCGAGAGCTTGTTAGCGACTCAAGTCGCCGCTTCGCTCACCAA
TTCTGGAGAGAGGATCGGCGTTATTGCCATTCGTGTTTACAGACCATTCT
CGGAACCGCACTTCCTCGAGGCACTCCCCAGGTCTGTCAAGAGAATCGCT
GTTCTTGGGCAGGTAGCAAATAAGGCTGCGGCAGAGGATAGCGCTGTTCA
ATCAGCTCTTTACGTCGATGTCGTGGCAGCGATCACAATGTCTGATATCT
GGACCCTCCCACCGCCGATTGTCGATGTCAAGTATGCCCGAGCGCAGGTC
TGGTCGCCCAAGGAATTCGCTTGGATCTTCGACCAGATTGCCCGCAGTCG
CACTGTTGTTGTCGAGATTCCTGAAGAGGAGCTCACCGCCCAAGCATCTA
CTATGGACGCCTTCATTCTTTTGGGAGATGGCAGCCATGCCCAACAGTAC
GTTTTCTGGGACGGTGACGATGCTGCTTCAGCACCCGCGGCATCAATCAT
TTCCAGACTTCTCTCGGAGGATCCCCGTAAGAGCGTTTCTTTCCAGGCTG
CGTACGATAACGTCCCGCTGTCTGGTATTCTTCACTCCGAGATCAGGGCC
AGCTCCAGCGCCATCGATGCACCTTTCCACATTGAGTGCGCGGACATTTC
CGTGGTCAACGATATCCAGCTTCTTTCCAAGTTCGATATTGCCAGCCGGA
CCAAGGATAGCGGGATCATCCTTCTCAAGTCGACTATCAAGGACGACGAG
TTCGAGAAGAAGCTCCCAGCACTTTTCCGACGTGCAGTTACCAAGAAGGC
CATCAACCTAATCATCGCGGACCCCTCAGCCCTCGGAGACGAGGCCCCTG
CAGCAGTGGAGAATGCCCTCATCCAGCTAGCCTTCGCCAAACTCGCCAAC
ATCAGTGCACCCCTTGAGAAACTCTCATACCTCAACATCGATTCCTCCAC
CGTCCACCAAGCCTACGAAAGGCTCGACAGTTCATTGCGCAATGTGGAGA
TTCCAAAGGAATGGGCTGATTCTCTAGAAGATAACGAGCCCAGCCACCTC
CCCACAATCCCACAGACAACCAGCTTCGCCATTAACGAGGAGAAGCACAC
CACAGAGCCCGCCCCGGCCCTCAAGACTTCACAATCGGCGGCGCAGGCCA
TCGTCTTCAAAGAGGCCTACGACGTGCAATCCGCCCTGCGCCCGGACCTC
TCAATGAAGAACTACATCGTCAAAGTGCAGGAGAATAGACGCCTGACGCC
AGAGTACTACGGCCGCAATATCTTCCACATCGAGTTCGACCTAAGCGGTA
CGGGAATGGAATACCAAATCGGCGAAGCCCTAGGCATCCACTCCCAAAAC
GACCCGGACGAAGTCTCCGAGTTCATAGAGTTCTACGGCCTGAACGCGGA
CGACATCGTCGAAGTCCCGTCCAAAGACGACCCGGACGTGCTCGAGATGC
GCACCGTGTTCCAAGCGCTGTCGCAGAACGTGGACATATTTGGCCGGCCG
CCGAAGAAATTTTATGAGTCGCTGGCGGAGTTTGCTACGGATGAGGGGGA
GAGGAAGGCTTTGCTTACGTTGTCGTCGGCGGAGGGAGCTACGGAGTCTA
AAAGGAGGGCAGAGATGGATACGGTCACTTTTGCGGATATCTTGGCGGAG
TACAAGTCGGCTCATCCGAGCTTTTATGAGCTTGTCAGGATTGTCAGCCC
GTTGAAGAGGAGGGAGTACTCTATCGCCTCCAGCCAGAAGGTCAATCCAA
ATAGTGTGCATCTCCTGATAGTTGTGGTGAATTGGGTGGATACGAAGGGA
AGGGATAGGTTCGGACAGGCGACGAGGTATCTCAGTCGTCTGCCAATTGG
AGCGAAGGTGACCGTTAGTGTCAAACCCAGTGTCATGAAACTTCCTCCCT
TGGCCACGCAGCCCCTCATAATGGCAGGCCTCGGAACCGGTCTCGCCCCC
TTCCGAGCCTTCGTCCAGTACCGCGCGTGGCAAAAGTCGCAAGGCGTGGA
CATTGGCTCCGTCCTGCTGTACATGGGCTCCCGCCACCAGCGAGAAGAAT
ACCTCTACGGAGAGGAATGGGAAGCCTACCAAGCCGCTGGCATAGTGACC
CTCCTTGGACGCGCATTCTCCCGCGACCAGTCCGAGAAGATATACATCCA
GGACCGGATGCGCCAATCGCTCGACGACATCATCGAGGCGTACATCAAGG
AGGACGGGGCCTTCTACCTGTGCGGCCCCACGTGGCCGGTTCCGGACGTC
ACGGAGGTGCTGCAGGAGGCTATCGTCGAGGAGGGCAAGAGGCGGGGCGC
CAAAGTAGATGGGGCGAAGAAGATTGAGGAGTTGAAGGAGGGTCTGAGAT
ATGTGCTTGAAGTTTATTGAGGTGGGGGCTTGTGCTATTGCGGGTGTGGT
TGGGTTTGCGGTGATATTTGGTGAAGGGGTGTATTTCCTATTTCTGTTTT
TCGGGTTCTGGATGCTTGGGTATCCGATGCTGTGCTGTGTATAGAAAAAT
AGAATTGTCTCTTTCTCTCCTGAACTATGATACCGATTGAGGAGGGACCG
TGCTTAAAGAGTTTGAAGCCGGAGAAGGAGAGACAAATCTAACTGGG

Sequences in the Contig:

SY0AAA11YI16FM1 SY0AAA14YO24FM1 SY0AAA25YE22FM1
SY0AAA28YA17FM1 SY0AAA33YL06FM1 SY0AAB11YC14FM1
SY0AAB22YC08FM1 SY0AAB24YB18FM1 SY0AAB27YD09FM1
SY0AAB51YN23FM1 SY0AAB55YE16FM1 SY0AAC17YP08RM1
SY0AAC19YB19FM1 SY0AAC19YB19RM1 SY0AAC22YE15FM1
SY0AAC28YK09FM1 SY0AAC34YN17FM1 SY0AAC36YE14FM1
SY0AAC3YF10FM1 SY0AAC43YE17FM1 SY0AAC46YB18FM1
SY0AAC4YM20FM1 SY0AAC50YA01FM1 SY0AAC52YB16FM1
SY0AAC53YC07FM1 SY0AAC5YC11FM1 SY0AAC61YB19FM1
SY0AAC6YC11FM1 SY0AAC7YH08FM1 SY0AAC8YI05FM1
SY0AAD10YC11FM1 SY0AAD22YC17FM1 SY0AAD30YF24FM1
SY0AAD30YP17FM1 SY0AAD32YO14FM1 SY0AAD38YB24FM1