Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4531
Length(NT) : 1886
Best Gene Model Blast : Link to GSTUMT00001944001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: mRNA capping enzyme, beta subunit, putative
Accession: ref|XP_001267171.1| Score: 748 E_value: 5e-77
KEGG Definition: mRNA capping nucleoside-triphosphatase, putative
Accession: afm:AFUA_4G08510 Score: 747 E_value: 3e-77
KOG Definition:
Classification: [Intracellular trafficking, secretion, and vesicular transport].
Kog Number: KOG0307 Score: 167 E_value: 3e-12
PFAM Definition: mRNA_triPase, mRNA capping enzyme, beta chain. The beta chain of mRNA capping enzyme has triphosphatase activity. The function of the capping enzyme also depends on the guanylyltransferase activity conferred by the alpha chain (see pfam01331).
Pfam Number: pfam02940 Score: 460 E_value: 3e-46
Swissprot: Q9P6Q6|CET1_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0042803 = Molecular function: protein homodimerization activity

Sequence:
>Contig4531
TTGGCAACAACAACCACAACCTACTCAACTGCCATCCACTTCCAACAGCA
ATAGCAATCTTTCCCAGCAACCTTCCTCCCAACCTTCTTCGGGCGCGTCT
TCGCAAAGAACATCGACCGTTTCTCCTAGCAACAAAGAGCAGCCTCATCC
ACCACCCTCTACATTAACTCCCCAGACGAAAAAGTCGACCCCGACCCCTA
CGAATATCAGCCCTCGGCATCCCCCGCCCCAGCCGTCATCGAGTCCAAAG
GGTGCGCATCAGTTGGGTCCACCGCCCACGCCATCTCAGAATCAAGCGAT
CGTGGAGGGAGGTACCAGCAGTAGTCCCGGGTCGTCCGGGCCTCCCAAGA
AAAGAGCTCGAAGAGATGAGGCTCCGATCTGGGCGAGAAAAGCTAGTCGG
AGTTCTAGTAGTAGCCCCGTATTGGCGAATAGGAGACAACCAAGCAGCGC
AAACCAGCACCAACCTCCTCTGCAACAGCAGCCGCCGCCGCTTCCGCCAC
CGCCTCCACAACAGCACCAGAAACCTCCTCCGGCAAGCGGATTTACCCCC
CGTTTTGTTCCGTGCTTTGGGGCCTGGGAGCCTTCCATATGCAACACGGA
ACCTTATGAAGAGTTGACAAGGGAGGTTGCGAACTTCTTGTTCAACCAAG
TTGTGTGTCAAAACGATCCAGCACTCACTTCGTCAGGGGGAGATGGTCCA
GTTGTCATGATTGAGATTGAAGCCAAGATTGGTCATTTGATTGACAAGGA
ACGAGGCGAGAGATTGAAACTTCCGGTCGTCACGGAAACAGTACTGAATG
TTGATGAACCAGGATGGAAAATCCAATTCAAGAGTAGCATGACTGAGGCA
CAACACAAGCGCCTCAACTTATTCCTCAACCTACAATTCAGCGAATCCAA
AGGACTCCCTCCCCCCGGCATGCCCCCATCCCCATCATCCGAGCACCCGA
ATGAGAATTCCCGACCGCCTGCAGGGCCCCAGCGTATCCCAATGGACTAC
GTGCACACCCGTGAGAGGGATACCTTTTTCGAGCTCCCGCCGGACAAGTT
TCAAGCACTCCCCAATATCCTGCGCTCATATATGCGACACAAACCCAAAG
TACGTGTGACAATTGACCAGAAGACCGGAAAGGTTATCAACAAGATTATC
AAGACAAGAATCGCAGATCTCAACGTCTATTCACCAAAGACCGCATTTGA
TTGGCGGGTTAGCGCGAATATCGAAATGCCATACCCGGGCGACATCGATG
GGTTACAGCCTTCAAGTGATAGGGGCGGCGGAGACAGGAACAAGGATAGG
CTAAGCTACCGGCATTTAGCCTACCAAATCGATCTCACTCAAGTTACGGA
TAATACTGCGAGGAAGGAACACGAGCTTGAGGTTGAAGTGTCTGGGCAGG
AAATCATAAGACACGGAAACCTTGCAAGGGAGAAAAAGCCGAATGCTTAC
GAGTATCTGGTTCGTGGGTTCGTGGATAACGTCCGAGTTCTCATCAGGGC
TATTGAGCCGTAATGCCGTTGATAGATCGGAAAGGATAATCATATTGGCG
GATTACTTTTTCTCTCTCTTTTGTCCCTCATTCCACGGCTTCAAGCTTCT
CGGGGAGCTTTCACTGTACACAATTTTTTTTGTTCACCTTCTCCTTACTT
TCATTCTTCCCCCCGCTGCTTGCTCGGAGTGACCCATGGGGTTTCTTTCT
TTATACTCGCTAGTGCAAATTTGCCTGTTTTTTTTCATTTCTCTTTTCAC
AACCGCTTGTATTGTACTATTCTGGTGACATTTCTTTGGTGTACACTGCC
TTTTTCTATCTCTCCGTTCCTGCTCCGATAATTTCCTTTTCCAAACACGA
AAAAAGCCAAAAAGTTCTCAATTGCTGCGGTTTAAG

Sequences in the Contig:

SY0AAA34YI07FM1 SY0AAB15YD15FM1 SY0AAB2YA12FM1
SY0AAC34YN15FM1 SY0AAC42YJ15FM1