Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4530
Length(NT) : 1610
Best Gene Model Blast : Link to GSTUMT00011280001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE59020.1| Score: 1001 E_value: 1e-106
KEGG Definition: acyl-CoA synthetase
Accession: aor:AO090023000479 Score: 1001 E_value: 1e-106
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1176 Score: 796 E_value: 3e-85
PFAM Definition: AMP-binding, AMP-binding enzyme..
Pfam Number: pfam00501 Score: 702 E_value: 2e-74
Swissprot: Q3URE1|ACSF3_MOUSE

Sequence:
>Contig4530
TTGGCAACAACCCGCCAAGCTCGCAGAATGATCCGAAGAAATATTACTGT
TGAGACATTACCTCGGCTACCAATCTTCGAAGCTCTCTCTAAACACAATC
CAAAAAGCATTGCGATCGTTCACTCCGAGTCCGGAGATAAATTTACATAT
GACAGCCTATTATCAGATACAGCAAAGCTCAAGAGAAAACTACTGGAGAA
GGCCAAAGTTGACGATTTGCAAGAACAGCGAGTGGCGCTTTTTGTAGAGA
ATGGGTACAACTATGTAGTTTCATTATTGGGCATATTTGCAGCGGGTGGA
ATAGCAGTTCCTCTGCACCCCAACCACCCACCCGGAGAACTTCATTATGT
CGCTAAAAACTCCGCACCGACATTCATCCTAACCCATTCCAAAGCTCATC
AAGCATTCCCCCCAAGCTCTAGTTCCCCACCAATCCTCGACCTTTTCGAG
CACCCCCCCAACAAACCGCACGATGCTCCGGCACCGGTAGATCTTTCCCC
AGCACCAGACCCCCTCCGAGGAGCCTTAATGATCTATACCTCTGGCACAA
CCGGCGCCCCCAAAGGCGTAGTCTCTACCCACAAGAATCTAACAACCCAA
GCAGAAACTCTAGTTACGGCCTGGGAAATGTGCAAAGATGACCATCTCCT
ACACGTCCTCCCCCTCCACCACGTTCACGGAATTGTAAATGCAACCCTAG
CTCCGCTCTTTGCCGGCGGAGCAGTAGAATATCTATTCCCCTTCAACGCC
CAAAAGATCTGGTCCCGTTTTGCCGATACCTCGAGGAGGCCAATAAGTCT
GTTCATGGCTGTACCAACAATATACTCCCGTCTCATAGACTCATTCGAGA
CGTTATCGGAGCCTACGCGCTCTGCGGGTAGGAAGAATGTGTCGAATTTG
CGGTTAGCGGTATCGGGCTCTGCAGCACTGCCGGCGAGTACAAAGCGGAA
GTGGGAGTCTCTGGGCGGGAATCTATTAGAGCGGTATGGGATGACTGAGA
TTGGTATGGCGCTCTCTCAACGCTTACCACTGACCGACCGAATGGCAAAT
TCTGTCGGGTGGCCGCTGCCGGGCGTCGGAGCACGTCTTGTGAGCGATGG
TGTAGAGATCAAGGAAGTTTGGCAAGAAGGGGAGATACAAATCCGCGGTA
ACAGCGTCTTCCGCGAGTACTGGCAGAAGGAAGAGGCAACGAAAAAGGAG
TTTACACAGGATGGGTGGTTCAAAACTGGAGATATAGCGGTGCGCGATGA
GCGGGGGGCGTACTATATCAAAGGTAGGACAAGCGTTGATATACTTAAAT
CCGGCGGCGAGAAAATATCCGCCCTAGAAGTCGAACAAGAATTACTTGAG
CTGCCGCAAGTGGCTGAGGCTGTAGTAGTAGGTCTCACAGACGAAAGGTG
GGGGCAGAGAGTCGCAGCGGCGCTCGTGCTCACACCGCAGGGCAAAAGCG
AAGAATTTGACTTAGTAAAGATGAGGGCTGAGATGAAGAAGCGGGCTGCG
GAGTATAAGGTCCCAAGAGAAATCAAGATTTTGGAGGCTATCCCGAGGAA
TCATATGGGGAAGGTTAATAAAAAGGAGATTGTGAGGGAGGTTTTTGGAG
AGGATGAGCC

Sequences in the Contig:

SY0AAA15YO04FM1 SY0AAA32YL04FM1 SY0AAC13YE14FM1
SY0AAC30YM16FM1 SY0AAC34YN11FM1 SY0AAC43YL03FM1
SY0AAC49YO11FM1 SY0AAC8YF19FM1 SY0AAD26YL22FM1
SY0AAD57YH12FM1 SY0AAD59YD09FM1