Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig453
Length(NT) : 247
Best Gene Model Blast : Link to GSTUMT00003993001 E-value : 8e-16
Numbers of ESTs : 8

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig453
AGAAAAATTCCGATGAATACATCTATGCTATCTTATACCAAAAAATCCTT
ATCCGGAGCTCAATTAATTCTTCTTCTTTTGGGAAAACAAATCTAGACAG
AAATGAGATGAAAAGAAAGATAAATTTTATAAGTGGTAGTCCATATATAT
ATCCGTGCCAACTCTTGAAACAAGGACAAAACGAAATAAACAAAATAAAC
GGGAAGCAAAAACATAAACCAAAAAGCCCGCCGGGGGGGGGGGGGGG

Sequences in the Contig:

SY0AAA21YG11RM1 SY0AAA23YH15RM1 SY0AAA24YF15RM1
SY0AAA24YK19RM1 SY0AAA30YJ08RM1 SY0AAA31YH03RM1
SY0AAA31YH11RM1 SY0AAA32YE10RM1