Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4529
Length(NT) : 811
Best Gene Model Blast : Link to GSTUMT00010517001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SS1G_14217
Accession: ref|XP_001584762.1| Score: 328 E_value: 8e-29
KEGG Definition: hypothetical protein
Accession: ang:An06g01210 Score: 320 E_value: 3e-28
KOG Definition:
Classification: [RNA processing and modification].
Kog Number: KOG3117 Score: 203 E_value: 6e-17
PFAM Definition: No Hit Found
Swissprot: Q09713|YA36_SCHPO
Gene Ontology:
GO:0005634 = Cellular component: nucleus

Sequence:
>Contig4529
TTGGACTACCCCCTTCAGGAAAAACCCCGTTCAGACGTAGCAGCAGCTTC
AGCACCAGTATCAGCACTCACCAGGAAGGAACTCGCTTTCCGTCCTAATC
CCGCCGCTCTTGTAAAACCCTCTGCTCCGGCGCTATCCTCATCTACTACG
AACCTCTCCGATGGCATATACCGCCCACCTCGCATCTCCGCGACCGCAAT
GCCGGAACCCAACAGGTCCGCGGAGAAAGGTAAGCCTCCCCGCCGCAAAT
CCCATATGCTCGATGAATTCGTTATGGAGGAGTTGTCCACCGCGCCAACA
GTGGAGTCATCCGTCGGGTCCACCATTATCGACTCCGGCCGCGTAGTCAA
GACCGCACGCGATAGGCGCGAGGAGCGAGAGAGGCAGGAGTACGAGGAGA
ATAACTTTGTCAGGCTGCCGAAGATGGGTAAGAAGGAGGCGAGGGAACTG
AAGCGCCGCGGTGGGAGAGAGGTGAACGGCATGGGCGGTGAGGATTGGTC
GGGTTTCACGGGGGATATAGAGAGGTTGACGAAGGAGGTTGATAGAGCGG
GTAAGAGCGCAAGGTTGTTGGAGAAGAGTCGGAAAAGGAAGGGTGATGGG
GATAATGAGGAGGGGGGCAGCTCGAGGGTTGTGGGGGACAGTTTTGAGAG
GAAGAAGGAGAGGCTTTCTAAGAGGAGGAAGACTTAGATGAGTGAGTCTA
TGGATAGATACATAGACATAGATAGATATTTTAAAAGTTTTCATCCCTTT
TGAGTCGCTACTTTGCGCTTGACCTGTATCATCATTAATCCACTCCATTT
CCACAAACTAG

Sequences in the Contig:

SY0AAA32YK03FM1 SY0AAC34YN10FM1