Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4528
Length(NT) : 1527
Best Gene Model Blast : Link to GSTUMT00004765001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein BC1G_10737
Accession: ref|XP_001550193.1| Score: 1437 E_value: 1e-157
KEGG Definition: hypothetical protein ( hypothetical protein B1D1.160 [imported] - Neurospora crassa OR74A )
Accession: ncr:NCU01675.1 Score: 1334 E_value: 1e-145
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG1248 Score: 810 E_value: 6e-87
PFAM Definition: No Hit Found
Swissprot: Q12754|RRP12_YEAST
Gene Ontology:
GO:0005634 = Cellular component: nucleus
GO:0005840 = Cellular component: ribosome
GO:0000462 = Biological process: maturation of SSU-rRNA from tricistronic rRNA transcript (SSU-rRNA, 5.8S rRNA, LSU-rRNA)

Sequence:
>Contig4528
TTGGAGAATATTGCTCACCTTGCATCCTATTCTGGGAATATGCTGGCAGT
TTTGTTTAATGTTTACAGTACGACGCTGCCGCAATATCGTGGGTTCATAC
TCAAGTGTCTCAATTCTTTCTTGAGCATCACTCCTGACACAGAACTTACG
ACAACGTTCCAAAAGGTTACTTCGATGCTTGAGGCAACCCTCGCCGAACC
CGTCAGGAAAAAAAGCGAGACAGAAGCTGCTGGGGATACCAGGATGCCGC
CGATGGCACATACGCTTATGGATTTGGTCATCACCATTACACCATATCTC
CCGTCCGGCAGTCACCTGACACTTTTTAGAATCTTTTCTGTGACGGTGGA
CAAGAGCGAGGACCCGCAATTGCAGAAAAAGGCGTACAAGATCATACCAC
GACTAGCAGAGGCAGAATCTGGCAAGCAAGCATTAATTCAGAAATCTGAG
GATCTACAAAATTTCCTAATAGATGCTGCTGAGAAAGCTACTTCTCCTGC
TAGAAGAGACCGCCTAATAACTCTCTCCCAACTTACCGAATTCCTCCCAA
CCACAGATCTGCACTTCATTCCATCAATCCTTTCCGAGGTAGTTATCTCT
ACAAAGGAAGTCAACGAAAAGGCCCGCACAGCAGCTTTTGACCTGCTAGT
CCTCATGGGAGAGAAAATGAAATCCGGCGGCGTGGTAATAAATAGCAAGG
TAACCCATATGCCCTCGGACGCCTCGAATGTCGCTGCAACACTCGACGAA
TACATCACCATGGTCTCCGCTGGTCTCGCAGGCAGCACGCCACACATGAT
TAGTGCGAGTATAACCGCCCTTACCCGTATCTTATACCAATTCAAAAATG
ATATAAGCAAGCCCCTTATCTCGGAAATTATAACAACCTTAGACCTCTTC
CTTGCCAGCAAGAACCGTGAAATCGTCCGCTCAGTTCTGGGCTTTATAAA
GGTGTGCATAATCTCCCTACCAAAGGAAACTATGCTGCCCAGGTTCAACA
CCTTAATTCCGAACTTGATGATCTGGAGCCACGAGCACAAAGCACATTTC
AAAGCGAAGGTCAAGCATATTATAGAACGCATGGTCCGACGCTTTGGCTA
TGAGGCTGTGGAAAAGCACGTTCCAGAGGATGATAAGAAACTGGTAATTA
ACATCCGGAAAACTCGGGAGCGGAGGAAGAAGCATAAAGACGCCATCGCC
GCCCCTAGCTGTGATGAAGACGGTGGCGATGTAGAAGTAGATGCTGTACC
GAAAGCGAAACGCCAGAGTAGGTTCGCCTCAGAATTCGAAGCTGCAATTT
ATGACTCCGACTCCGACATGTCTTGTGACTCGGACGCTGAAGTTGATTCC
ACCCCGCGTCGGAAGAACAAGCGTGGTGGTAAATCTGGCGAAGCATACAT
CCACGAGGGAGAAGACGAACCACTCGACTTGCTCGACCGGAAATCCATAG
CGAACATTTCTTCTACCCGACCGCAACGCGCCCGGTTTGGGGATTTGAGA
AAGTCTGCTACAGCGAAGGCAAGGACT

Sequences in the Contig:

SY0AAA22YP04FM1 SY0AAA8YJ12FM1 SY0AAB26YD02FM1
SY0AAC34YN05FM1