Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4527
Length(NT) : 549
Best Gene Model Blast : Link to GSTUMT00000078001 E-value : 1e-129
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein BC1G_08870
Accession: ref|XP_001552392.1| Score: 311 E_value: 3e-27
KEGG Definition: hypothetical protein [EC:6.4.1.4]; K01968 3-methylcrotonyl-CoA carboxylase alpha subunit
Accession: ani:AN4690.2 Score: 296 E_value: 9e-26
KOG Definition:
Classification: [Lipid transport and metabolism, Amino acid transport and metabolism].
Kog Number: KOG0238 Score: 249 E_value: 2e-22
PFAM Definition: CPSase_L_chain, Carbamoyl-phosphate synthase L chain, N-terminal domain. Carbamoyl-phosphate synthase catalyses the ATP-dependent synthesis of carbamyl-phosphate from glutamine or ammonia and bicarbonate. This important enzyme initiates both the urea cycle and the biosynthesis of arginine and/or pyrimidines. The carbamoyl-phosphate synthase (CPS) enzyme in prokaryotes is a heterodimer of a small and large chain. The small chain promotes the hydrolysis of glutamine to ammonia, which is used by the large chain to synthesise carbamoyl phosphate. See pfam00988. The small chain has a GATase domain in the carboxyl terminus. See pfam00117..
Pfam Number: pfam00289 Score: 174 E_value: 7e-14
Swissprot: Q42523|MCCA_ARATH
Gene Ontology:
GO:0005759 = Cellular component: mitochondrial matrix
GO:0004485 = Molecular function: methylcrotonoyl-CoA carboxylase activity

Sequence:
>Contig4527
TTGGCTTCATTCTCATACTATACAATTCACTACTCCTCCTACTTGTTTCT
CCTTCATTCCAGCTTTTTTTTTTTTTTTCCCCAAAGGGAAATGCCTCGCC
CACACCTTGCCCGGCGTGCTCTACTGGGCCTAACACCATCCACCCTCCGT
TGGCAGAGCAGCAGTGTTCCAAAAGCTCGCCCGCTGACAAGTATACTCAT
TGCAAACCGTGGGGAGATTGCATTGTACTCCTCCCTCTCCCCCCACAGCC
CCAAATTATCCCTCCCCTCGGGAGCACGGTGCTTGGTACAGTGGTTTGTT
AACAAAAAGTGGTGCAGGAGAGTCAACCGGACGGCAAGCAAATACGGCAT
CCGAACAACAACCGTATACACAGATCCGGACACACATGCACAACATGCGA
GTGTGACGCCGCATTCTGTAAATTTGGGACCGCCGTCGGCCTACCTTGAT
GTCGATAAAATAATCAGGGCCGCAAAGGAGAGGGGGTGTGATTCTATACA
TCCTGGGTATGGGTTTTTGAGTGAGAATTCGGCGTTTGCAAAGCGAGTC

Sequences in the Contig:

SY0AAC34YM18FM1 SY0AAC62YO05FM1