Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4526
Length(NT) : 1168
Best Gene Model Blast : Link to GSTUMT00006123001 E-value : 0.0
Numbers of ESTs : 5

Blast Results:

Nr Definition: hypothetical protein BC1G_00597
Accession: ref|XP_001560569.1| Score: 879 E_value: 2e-92
KEGG Definition: hypothetical protein
Accession: ang:An07g09890 Score: 799 E_value: 2e-83
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: P32843|RNA12_YEAST
Gene Ontology:
GO:0031305 = Cellular component: integral to mitochondrial inner membrane
GO:0000002 = Biological process: mitochondrial genome maintenance

Sequence:
>Contig4526
TTGGAGAACACCGGAACGGCGCTTAAGGTAGTGGCGCTTCGAGATAAAGG
TACCGACAATAAGGACCAAGGACTCAGCGACGACGAGTACCTCAGCGCAC
ACCCCGAAAAGCGTCCCGTAATAGTAATAGATAATTTCCTGCATATGGAG
GGCAATAGCATAATCTACGAGCGTCTCGCAGACTGGGCAGCACTCCTCGT
CTCGGCGAACATAGCCCACGTAATATTCCTAACCAACGATACCTCCTTCA
GTAAATCGCTTGCGAAATCCCTGCCTGACCGCGTCTTCCGCTCAATCCTG
CTGGGCGACGCTCAGCCAGATTCCGCAAAGCGCTTCGTGCTAAAGCACAT
CGACAACCAACTCGACGGCGCCGCCAATGAAAAGGCCCGTGCGGAGCTCG
ACGACAGCATCCAAGCCCTGGGTGGCCGCCTAACAGACCTAGAGTTTCTC
TCTCGCCGCATCAAAACCGGTGAGACGCCGAAGCAAGCTGTCGGCGCAAT
TATCGAAACCTCGGCGCAAGAGATCCTCAAGCTTTACCTCCTCGAGGAAG
CCGGCCGTGGCAAGCGCACCTGGGCCACCGAGCAAGCCTGGTACCTCGTC
AAGACGCTCGCGGAGAAGGGTGAAGTCGCCTACCACCACGTACTCGTCCA
CGACCTGTTCAAGTTCGCTGGCGAAGATGCGCTGCAGAACCTAGAACAGG
CCGAGCTTGTCACCATCGTCACGAGGAATGGACGGCCCTGGTGCATCAAG
CCCGGGCGCCCTGTGTTCCAGGCTGCCTTCGGGCGCCTTATGGCGGACCG
CGTGCTGTGTGCCCGCATGGACTTTTTGAGCCTCGCTTCGCTAATTAAGG
TCGAGACGGCAGCCATCCAGAAGGCTGGCGAGGAACTCGAGAAGATTGCT
GGGCTGCCGAATCGGCCGAAGGAGAGGATGAGATTCCTGCTCGCTAAGAT
CGCTGAGGCGCAGGGGAAAATTGACAAGTATGAGGAGGGGATGAAAAAGT
TGAAGGCGGTGCTTAAGGAGGAATATTGACTTGGCTAAGGCGGTGCGGTA
CGGTTTTTTGTGCACTTCCTGCATTACTAATGGGAACACGAGCATGTAAA
TGGAAGTTTAGCCTAGACACCGCTTCGTGCGAAATCTAGCGAAGGGTACA
AACACCCTATCGCACTCC

Sequences in the Contig:

SY0AAC26YG13RM1 SY0AAC34YM08FM1 SY0AAD60YB07FM1
SY0AAD6YK03FM1 SY0AAD8YK23FM1