Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4525
Length(NT) : 3143
Best Gene Model Blast : Link to GSTUMT00005537001 E-value : 0.0
Numbers of ESTs : 23

Blast Results:

Nr Definition: hypothetical protein CIMG_00961
Accession: ref|XP_001247190.1| Score: 3938 E_value: 0.0
KEGG Definition: conserved hypothetical protein
Accession: fgr:FG10203.1 Score: 3652 E_value: 0.0
KOG Definition:
Classification: [Amino acid transport and metabolism].
Kog Number: KOG1939 Score: 3775 E_value: 0.0
PFAM Definition: Hydantoinase_B, Hydantoinase B/oxoprolinase. This family includes N-methylhydaintoinase B which converts hydantoin to N-carbamyl-amino acids, and 5-oxoprolinase EC:3.5.2.9 which catalyses the formation of L-glutamate from 5-oxo-L-proline. These enzymes are part of the oxoprolinase family and are related to pfam01968..
Pfam Number: pfam02538 Score: 1663 E_value: 0.0
Swissprot: Q10094|YAOF_SCHPO
Gene Ontology:
GO:0005829 = Cellular component: cytosol

Sequence:
>Contig4525
GTATGCCCTGACATCGTACGACCCTGAAACCAAGATACCGGTAATTGGGT
TTGATATGGGCGGAACATCAACAGATGTTTCAAGATATGGCTCAGGGCGG
TACGAGCATGTATTTGAGACTACTACTGCCGGTATTACCATCCAGAGCCC
TCAATTGGATATTAATACCGTGGCAGCAGGTGGTGGCTCTCGGTTGTTCT
GGAGAAATGGGCTGTTTGTAGTTGGACCCGAATCCGCTGGAGCTCACCCT
GGCCCTGCCTGTTATCGGAAGGGCGGTCCGCTGACTGTGACGGATGCCAA
CTTGTTCCTCGGCCGACTGCTGCCAGAATTCTTCCCGAAGATCTTTGGAA
AGAGTGAAGACGAAGCTCTAGATGAGTCTACGAGCGAGAAATTATTTAAA
GAGCTGACCGAGGAGATTAATAAAGAATTATGCGCAGAGGAGGGCAACAA
ACCCATGTCTCCAGAGGAGGTTGCGTATGGATTTATCAAAATTGCGAACG
AGTCCATGACTAGGCCTATCAGGAGTTTGACTGAAGCTAAAGGGTACGAC
ACCTCCGTTCATAGGCTTTCCACGTTCGGGGGTGCAGGGGGGCAGCATGC
TGTTGCAATCGCGGAAAGCTTGGGTATCCGCCAAATTCTGATCCACAAAT
ACTCTTCCGTGTTGTCGGCCTATGGAATGGCGTTGGCGGACGTTGTTCAT
GAAGTCCAGGAACCCAGCTCCGCCGTGTTTGGCAAGGAGCAGAAGGCCGG
CTTGGTTAGCAGACTTGAAGAGTTGAAGGGAAAGGCAGCTGGCGTCCTGC
TTGAGCAAGGTTTTGACGAGCAGGACATTGTTCATGAAGAATACCTCAAC
ATGCGATATCGTGGAACTGAGTCGGCCCTCATGGTTGTCCGCCCCCAGAA
GGAGGAATTTGATGGCGAAGAGCATGAATTCGGCGAAGCTTTCGTGAGGC
AGCATGAAAAAGAATTTGGCTTTACACTCCCTAACCGAGACATCATCGTG
GATGATATTCGTGTTAGAGGGATCGGGAAGAGCTTCCGGGGGCTAGAGAA
AACCGTCGATCAACAATTGAAAACGATCGAGCCTACCCCAGTTGATCAGT
CAAAACGTCATAGTATGAAGAATGTGTACTTTGAGGGTGGCCGGCGGGAA
ACTCCACTCTATCGGCTCAGTGATTTGGCTGTTGGTGAGAAGGTTCAAGG
ACCCGCCATATTGGCTGATGGGACGCAGACTATTGTGGTTACTCCGGGAG
CCACGGCGCTGGTTATTGAAACCCATGTGGTTATTAACCTTGGTGACGCG
GACGAGCAACGGGCGGGACTACGAAAGATAAGTATGAAGGAGGTAGATCC
TATCATGTTGAGTATCTTTGCACATAGGTTTATGGCAATTGCCGAACAGA
TGGGTAGAGCTTTGCAAAAGACCAGTGTCAGTACCAACGTTAAGGAGAGA
CTGGACTACAGTTGTGCCTTATTCGATGAAAATGGTGGATTGGTTGCCAA
TGCTCCCCACTTGCCTGTCCATTTGGGTAGTATGTCGACGTGCGTCAGAA
CCCAGGCGGCTATCTGGAAAGGCAGGCTCAAGAGGGGTGATGTTCTTGTG
TCGAATCATCCTGAGTTTGGGGGTACCCATCTGCCAGATATCACAGTTAT
CACCCCCGCATTTAGTGGCGATAATATTATTTTTTATGTGGCATCGAGAG
CCCACCATGCGGATATTGGCGGTATTCTCCCTGGCTCCATGCCGCCTCAC
TCTCGCGAGCTCTATCAGGAGGGTGCAGCTATCAAGTCGGAAAAGTTGGT
ATCTGAGGGCCACTTTGATGAGGAGCGAATAACAGAGCTTCTTCTCGAGG
AGCCTGCGCAGTATCCTGGATGCAGCGGTACAAGATGCCTTGCGGACAAT
ATCAATGACCTCAAGGCTCAGGTGGCGGCGAACCAGAAGGGAATCAACCT
AATTTCAACACTAATAGAGGACTACGGCGAGGGCGTTGTCCAATTCTACA
TGACCTCCATCCAGAACAACGCTGAGACTTCTGTGAGGAATTTGCTGAAG
AGCGTTTACAAGCGATTTGAGGGCAAAGAACTAGTAGCGACAGAGCACAT
GGATGACGGAAGTCCGATTTGCCTCAGGGTTGATATAGACCCCCAGAAGG
GAGAGGCGGAATTCGACTTTCAGGGTACTGGGCCGGAGATGTATGGGAAT
ATGAATGCTCCTGAGGCAGTCACTTACTCGGCCATTATCTACTGTCTGCG
GTGCTTGATCTCGGAGGACATTCCTCTGAACCAAGGGTGCTTGAAGCCAG
TGCATGTTAAGATTCCAAGGCATTCATTCCTAAGCCCGAGTGACGGTGCA
GCGGTTGTTGGTGGGAATGTCCTGACGAGTCAACGCATTACAGATGTGGT
TTTAAAAGCGTTCCAAGCATGCGCAGCCAGTCAAGGTGATTGCAACAATC
TTACGTTCGGATATGGCGGAAGCCAAGATGGCGGCGACCATGTCAAGGGA
TTTGGCTACTATGAGACAATTGCAGGTGGTAGCGGAGCAGGACCTGATTG
GGACGGAACCTCAGGGGTTCATACACATATGACAAACACCCGCATCACTG
ATGCTGAAGTCTTTGAGCGCCGATACCCTGTCATCCTCCGTGAATTTTCT
ATTCGCAAGGGTTCTGGCGGTATCGGTGCACATCTTGGCGGTGATGGAGT
GATTAGAGACATCGAATTCCGAATTCCAGTTCAAGTCTCCATCCTTTCAG
AGCGGAGAGTCTACCACCCATATGGAATGGGCGGCGGTGGAGAGGCCGAG
TGCGGGCTCAATCTCTGGATTCGTGATAAAGACCAACGTCCAATTAATCT
TGGGGGAAAGAATACCGCTGCGATGAAACCTGGAGAGAGGATCGTCGTCC
ATACTCCCGGCGGCGGAGGCTATGGCAAGCCCGATGAGGAGAAGAAGCTC
AAAAACGTTCAAGATCCAAAGTATGCGTGGAGAGGAGGGAGCTTAGCCAG
CAGGCTCTCAACACAGGAGACAAATTGAGGGTGCCGGTTGGTTCTAAATG
TGTGCTTTTTTATTTGCTTGGTTGTAGGCGATTGTGTATATAATTCGTTC
TCCCGAATTAGCCACACCGTTAGTCTACGTGGGTTCTATGCAA

Sequences in the Contig:

SY0AAA23YH01FM1 SY0AAB47YP22FM1 SY0AAC11YK01FM1
SY0AAC24YO20FM1 SY0AAC25YG21FM1 SY0AAC28YF02FM1
SY0AAC29YC19FM1 SY0AAC34YM07FM1 SY0AAC34YP13FM1
SY0AAC34YP19FM1 SY0AAC47YC20FM1 SY0AAC49YG07FM1
SY0AAC53YB14FM1 SY0AAC55YM12FM3 SY0AAC58YA19FM1
SY0AAC5YK12FM1 SY0AAD12YO23FM1 SY0AAD20YI21FM1
SY0AAD36YG20FM1 SY0AAD39YE18FM1 SY0AAD44YB04FM1
SY0AAD48YJ21FM1 SY0AAD53YG08FM1