Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4524
Length(NT) : 823
Best Gene Model Blast : Link to GSTUMT00012031001 E-value : 0.0
Numbers of ESTs : 4

Blast Results:

Nr Definition: hypothetical protein SNOG_14327
Accession: ref|XP_001804519.1| Score: 539 E_value: 3e-53
KEGG Definition: cyclin (Pcl1), putative
Accession: afm:AFUA_1G04750 Score: 530 E_value: 1e-52
KOG Definition:
Classification: [General function prediction only].
Kog Number: KOG1674 Score: 128 E_value: 3e-08
PFAM Definition: Cyclin, Cyclin. This family includes many different cyclin proteins. Members include the G1/S-specific cyclin pas1, and the phosphate system cyclin PHO80/PHO85..
Pfam Number: pfam08613 Score: 165 E_value: 2e-12
Swissprot: P25693|PCL2_YEAST
Gene Ontology:
GO:0000307 = Cellular component: cyclin-dependent protein kinase holoenzyme complex
GO:0016538 = Molecular function: cyclin-dependent protein kinase regulator activity
GO:0005515 = Molecular function: protein binding
GO:0007049 = Biological process: cell cycle

Sequence:
>Contig4524
TTGGATTCGCTATACACCAGCATCAGCCCTGTTCACGCTTAGCACCACAC
CATCATCCCCATAAGTCTTGCGGTCCGGTACCCCTTCTTCATATACTACT
ACTTTCCCTTCGACCACCACGAATACAATCACGCAGATCACGAACACGGC
TACGAGAGAAACATCAGCAATCAGCAAAAAGGGTTATTGGCAACCGAGAT
CATACTACGCTGGATACAAACACCATTAATACCTAGTACAGAAGCTAGTA
GAATAACACTGCAAACCACCATACACATATACACACACACACACCACACG
CGCAAAATGCCAACCATGTCACGAAAAGACGCTCTTGAGGAGTTTATTCG
ATTGCCTGTGAGCAAGGAAATGATCTCGTATCTGGCTGTCAAGGCTGCCA
ACGTCATTAAATGTGAAAGCAACGCCGCCTTACCCCCAACTCCTCCGTCG
ACCCCACCAAATGGTGGTGTCGAGCCGGATTTTTCGGCTCTGAAGCCAAC
CCTGCCAACCCTCGAGGAGTTCATTACCTCGACAGTCGATAGATCCCGCG
TTCAGGTACCTACTTTGATGTCAAGCTTGGTATACCTTCAACGACTGCAG
AAGAGACTACCAGCAGTGGCAAAGGGAATGCGATGCACAGTCCACCGCAT
CTTCCTCGCGTCTCTGATACTTGCTGCCAAGAACTTAAACGATTCATCAC
CAAAGAACAAACATTGGGCCAGGTATAGCGTTGTCAAGGGATTTGATGGT
TTTGGGTTTTCGTTGACGGAGGTGAACTTGATGGAAAAGCAGCTCCTGTT
TTTGCTGGACTGGGATTTGAGGA

Sequences in the Contig:

SY0AAA14YB04FM1 SY0AAA35YP16FM1 SY0AAA39YH13FM1
SY0AAC34YM04FM1