Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4523
Length(NT) : 708
Best Gene Model Blast : Link to GSTUMT00001988001 E-value : 0.0
Numbers of ESTs : 15

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4523
TTGGCCTCCACGTCCCCCTTTTTCTCTCCTCCAGCCTACTTGCATTTTCA
TCGCGCACACCCACTCGCTCCCATATTGCCACATCCTTCATACCTTCTAT
CTCCTTTTTGTCCATCTTATAAGACTCCCTCCCCTCTTTCTACCTTGCCT
GGTAACATTCAACCAATATCTATACAAACTGTTTTCACACTCTGCTTACC
GCATTGCAATCTCCTCCGGTACTTTCACTACTTCACCCTCCCTAACACAA
ACTGTCCTACGAAGCAGCTACCTAACTCGCAGCCATCATGTCGAGCGCAA
TGAAGAAGCTTAAGCTTCTGCACCACCTCACGGCCGCTTCAGCTGGCGCT
ACCACATCCACTGGTGCTTTACCCCCGACCTCCTGCGCACAACAGCAACC
AATACCGCCAATCCCACCTCCTATCCCCCAAACAAATTTACCTTCTGCGA
AATACAACAACAATCACGCCGAGATGACCCAAGCCTTACGGTCGGCCCGG
CATGCATTGAACCTGCTCAATTCCCCTTCAACCCAAACTGCTCCGCAGGC
ACTTCACCACCAACCCGAATCGTTTAGGGCTTCGCCTTATACCCTTCACC
ATTCCACACCCAGGGCATCGACATGTCTATTGCCTCAGGCGTTTATGGTT
TTGACGCCTAATGATCCTCATCCAGCAATTTGCCTACCTGCGTCACCCCC
CCCCCCCT

Sequences in the Contig:

SY0AAA15YF07FM1 SY0AAA26YB01FM1 SY0AAA52YJ16FM1
SY0AAB10YL24FM1 SY0AAB9YL24FM1 SY0AAC25YM01FM1
SY0AAC29YC11FM1 SY0AAC34YM03FM1 SY0AAC4YG23FM1
SY0AAC55YH13FM2 SY0AAC60YF19FM1 SY0AAC61YN10FM1
SY0AAD39YF19FM1 SY0AAD3YF17FM1 SY0AAD46YP03FM1