Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4521
Length(NT) : 697
Best Gene Model Blast : Link to GSTUMT00002999001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4521
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGCAACAGTCTCCATCCTC
AAAGACGAGAGCCCACCCGCCAACATCCCTTCCTCCTCAGAAGACATCAC
GGAGAGCCGCAAGAGCAGCTGTCCCACGATCTTGCGCCCCGAAATCAGCA
ACAAACGTCTCGTCGGCCGCCCGCCCACTATGTCTGATTCGAACCCCCCG
CATTCTACGGATCCCCAAGATAGTCTACTTCAAAAGTCACACCTATCCGA
CGAGAATATGGGCAGTCAAGAAAACCCCGGCAGTCGGCATCACGCACCCA
GCCGTGAACAACACATGACTTCAACCGGGAGTGTATCCAGCCGTGAACAA
CGTGCCAGCCTGGCCGAGCAGGTGAAGGCGTGGCTTCGCAGCGAGAAACA
GCGACAGAAAGACCGCCGCGAGGGTAAGAGAGCTCTCCACCGAGCGTTAC
ACGGGCACTGCCCACCAGGTGAATTAGTGGACAGTGGTGACACTCCTGCC
CCCCCAGACCCAGACTCCAGTGGCGATGAAGAGACACAGAATTCATTGAA
CCAGTTGGAAGCTATTCTTGCAGGGGTCCAGGAATCCTCACCCGCTGACC
CTAGCCGCCACCAGAGTGCCTCAAGTAGGAGAGGCTCCTGGGGAAGGTCT
CGAGCGAGATCGCTGATGGTTAATGCATCGGACACAGACTATGCTTC

Sequences in the Contig:

SY0AAC11YA06FM1 SY0AAC34YL17FM1 SY0AAD8YE23FM1