Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4520
Length(NT) : 662
Best Gene Model Blast : Link to GSTUMT00011156001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: hypothetical protein SNOG_00911
Accession: ref|XP_001791578.1| Score: 686 E_value: 2e-70
KEGG Definition: hypothetical protein; K09272 structure-specific recognition protein 1
Accession: ani:AN6687.2 Score: 659 E_value: 1e-67
KOG Definition:
Classification: [Transcription, Replication, recombination and repair, Chromatin structure and dynamics].
Kog Number: KOG0526 Score: 631 E_value: 1e-66
PFAM Definition: SSrecog, Structure-specific recognition protein (SSRP1). SSRP1 has been implicated in transcriptional initiation and elongation and in DNA replication and repair..
Pfam Number: pfam03531 Score: 561 E_value: 1e-58
Swissprot: Q5AYE3|POB3_EMENI

Sequence:
>Contig4520
TTGGAAGCCGGACGACGTGCATAACATGATAGTGATAGGCCTAGACCCAC
CCCTCCGCCAGGGTCAGACCAAATACCCCTTCCTGGTAATGCAATTCAAG
CGTGAGGAAGACATGGAATTCGACCTGAACATAACCGAAGACCTCCTCAA
CGAGAGGTACGCGGGCAAGCTACAGATGCACTACGAAAACCCCGCGCACC
AAGTCGTCTCGCAGATCTTCAAAGGCCTAACCGGCAAGCGCATAATCACA
CCAAGCAGGGACTTTTCCTCCCACCACCAACAATCCGGCGTGAAGTGCTC
CTTGAAAGCCAACGAAGGCCACCTCTTTTGCCTAGACAAGGCCTTCATCT
TTGTTCCGAAGCCCGCGGTATTCATTACCTTTGACAAGATTGCACACATC
ACCATGTCACGAGTAGGAGGTAGTGTCTCCGCCTCGAGAACATTCGACGT
GACAGTCTCGCTCAAGTCGTCCGAGGGCGGCGGTGAGTATCAATTCAACA
ACATCAACCGTGAGGAGCAGTCCTCGCTGGAAGACTTCTTCAAGAGCAAG
AACCTGCGCATTAAGAATGACCTCGTCGACGACTCTAGCGCGCTCCTCGC
TCAGGCTCTCAAGGACCAGGACATGGACGACGATGACGACGTTGCTGCCG
CGAGGGGCTCCG

Sequences in the Contig:

SY0AAA53YP06FM1 SY0AAC34YJ22FM1