Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig452
Length(NT) : 974
Best Gene Model Blast : Link to GSTUMT00000729001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein BC1G_10200
Accession: ref|XP_001551374.1| Score: 467 E_value: 8e-45
KEGG Definition: predicted protein
Accession: aor:AO090026000607 Score: 386 E_value: 1e-35
KOG Definition:
Classification: [Function unknown].
Kog Number: KOG2886 Score: 208 E_value: 2e-17
PFAM Definition: No Hit Found
Swissprot: Q06089|YP098_YEAST
Gene Ontology:
GO:0005741 = Cellular component: mitochondrial outer membrane

Sequence:
>Contig452
TTGGACCATACACCACCCTCAACTCGTGGTGACCACCCTAGATTGGGGCA
TGATATTTGTCCCCATCGCCGTTCGGAATTTTTCTCAGCCCTCTTACCAA
CTTTCACAATGCCTACTACCCTCTCGACTCTCGTTCACTCCGGACCGATC
CATCTCCTAGCCTTCGGCATCCTTTTGGGATCCCAGTTCTACCAGTCATT
TATTGGCGGAGTAATAGCCTATAAAGCTCTCCCCCGCGCTCAATTCTCCC
AACTCCAACAAAAGATCTTCCCAGTCTATTTCACCATCCAAACCGTTCTC
CCAACCATCCTCCTCCTTACTCACCCCTCCATGTCGCTTACCCGCCTTAT
TAACCCCTCGTCTCCCTTTTTCTACAATTCCGGACTTCCCTTACTCTTTG
TTTTCTGCGCATCTCTGGCCAATCTGGCTGTGATTGGACCGGCCACCTCA
AAGATTATGCGCGAGCGTAAAGTTCAGGAGACCAAGGAGGGGAAGAAATA
TTACGATGAAGGGCCAAAGAGCAAGGAAATGGAAGCGCTGAATAGGAAGT
TCGGAGCGATGCATGGCGCCAGTAGCTTGATCAACTTGATTGGATTGTTG
GTGACTGGTTGGTATGGTGTTATTCTTGGGCATAAGATCCGGTGGTAGCT
TGGGGGCAGCTAGTTTGTTGAGCTGAACGCTTGTACCGAAGGTTGGGGTT
TTATGGAGTGAGATGCCAATGGATGCGCTACTACCGATATCAGCATGAAC
TGAAATGCTAAGAAATACAATGTTTGGTGGCTTGTTCCTGTGTCCTTACC
CTAATGTTGTATTCAGCTAGCGAAGCAATACAGTAGGGTTTCTACAGTGC
GAGTACCAGCCTGTGTTAAAAAAAAGAGATTGGAAATGTGGAAATGACAT
CTTAGAAACACGGTTGCTTAGTTGGCTTGTGCATTCTGGACGTCAGAAGT
GGTCCGTCCACTTCTCCGCCGTTT

Sequences in the Contig:

SY0AAA24YF14FM1 SY0AAA24YF14FM2 SY0AAA41YJ21FM1
SY0AAB12YE22FM1 SY0AAB14YF24FM1 SY0AAB50YC09FM1
SY0AAC27YF11FM1