Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4519
Length(NT) : 628
Best Gene Model Blast : Link to GSTUMT00001515001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: unnamed protein product
Accession: dbj|BAE59296.1| Score: 602 E_value: 8e-61
KEGG Definition: mevalonate kinase MVK/ERG12 [EC:2.7.1.36]; K00869 mevalonate kinase
Accession: aor:AO090023000793 Score: 602 E_value: 4e-61
KOG Definition:
Classification: [Lipid transport and metabolism].
Kog Number: KOG1511 Score: 482 E_value: 2e-49
PFAM Definition: GHMP_kinases_C, GHMP kinases C terminal. This family includes homoserine kinases, galactokinases and mevalonate kinases..
Pfam Number: pfam08544 Score: 115 E_value: 7e-07
Swissprot: P07277|KIME_YEAST
Gene Ontology:
GO:0004496 = Molecular function: mevalonate kinase activity

Sequence:
>Contig4519
GTCTCAGCGTCGCCAACAACGGCTGGCCATAAGACGCCAACGCCATCCCC
TCCAAGAGTCGTCTGATACTTTTCGAACCCCTCCGTTCTGAGCTTAGAAT
CCAACTCCTCCAGGATGTTGGCCTTCACTTTCGGCTTCAACAAGGTTATT
GAACACCCTCCTCCCCCCGCACCAGTAAGCTTTGTCCAACCGATCCCGGT
GTGATCAATCAGCTCCCGAATCCGCTCCAACTTTGGATGAGAGACACCGA
GCGAGACCAACAAGCCGTGATTGATGCGAATAAGCTCACCGAGCCGCGAA
AGAGATGGGCTTCCAGAAAAAGAAGTGAAATCGGGATCCGATATAACATC
ATGCGCTTCCGCCGTAATACGGTCAATCGTGTCCAGCATTGATTGTGTAA
TCTCCGGATGCGCATTAAGCATGTTGCGAACGTTGGCCAACTGCTCAGCA
GTTCTTCTCGGCTGTTTTGTGTCGACCAAAAGTAGAGGGAGCTCGGGAAA
GTTCCTCAAGTGAGTGACCTCGGGGGGTAGACTGTAATCCGTTCGTTTGA
AAAGCACAGCCCTCCCTCCTGTTGCCACAGTATTGTCGACACCACTTGGA
TTACCATGAATGCACATCTCTCCACCAA

Sequences in the Contig:

SY0AAB19YO24FM1 SY0AAC34YJ15FM1