Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4518
Length(NT) : 2021
Best Gene Model Blast : Link to GSTUMT00000649001 E-value : 0.0
Numbers of ESTs : 137

Blast Results:

Nr Definition: hypothetical protein SNOG_14342
Accession: ref|XP_001804533.1| Score: 1281 E_value: 1e-139
KEGG Definition: conserved hypothetical protein [EC:3.1.3.11]; K03841 fructose-1,6-bisphosphatase I
Accession: mgr:MGG_08895 Score: 1266 E_value: 1e-137
KOG Definition:
Classification: [Carbohydrate transport and metabolism].
Kog Number: KOG1458 Score: 1111 E_value: 1e-121
PFAM Definition: FBPase, Fructose-1-6-bisphosphatase..
Pfam Number: pfam00316 Score: 1027 E_value: 1e-112
Swissprot: P09201|F16P_YEAST
Gene Ontology:
GO:0005829 = Cellular component: cytosol
GO:0042132 = Molecular function: fructose-bisphosphatase activity
GO:0042802 = Molecular function: identical protein binding
GO:0006094 = Biological process: gluconeogenesis

Sequence:
>Contig4518
TTGGGGCTGTTGGGGCTTTTCTGCGGGACTCAAGTTTGGCTGGCATCTTT
GGCCCAGACACTTTGTGTTTGTGGCATGCGCATGGTGGCGATCACGGGCT
AACTTCCCACACCCCATTCTCTCTATTTGGGGCCAAAAGCTACTACCGTA
CCGTATTGCTCCCTGGTTTCAAGACGTCACGAGCCTCTTTCCATGCTTCT
TATGGCAAACCAGCTTCGCTCCACAACAAAAGAAAGGAAAAAATAGGATC
TGGACTAACAATGCGTTGAATTTCTGCCAATAACGGATGTCCCCTAATAT
CTTCGGTTATAGACGGGCAGGAGCCCTCACAGCTCCCCAGCGGCTTTGAC
GATGGGTAAGAGGAACATCGCGGGGAAGCAGCCCCAGCAGAGAGATGGAT
GAGGGACCAAAGTGTATTCATTGCTTAGCTCGGCAGTCGCAGCAATTCGG
GACGAGGGATTAGTTGATGCTCATGCTCTTCTTTCCCCACAAATGTTCCC
TCTTGTCCCTTCCTTCCATACTTCCGAGCTTACTGTAAATAGCCTGGGAG
GGTGGTGTAGCAAACTTACTTATTCTACCCTATCCCCTCTCTCCTCCATT
TTCCCTTCGCCCTTACCTTATTTCCTGCCTTCGTGAATACTCCCTTCTCT
TCTTAAAAAATCTTGGTCGTTTACAGACATGACTTCTAATGGAAGTGGAA
GTGGTCACCATGGCGACTCTGAGGTGAAGACTGACATTATCACTCTTACT
CGCTTCCTTACAGAGGAGCAGCATAGACTTGGTCCACATGCCACTGGGGA
CTTCACATTGCTATGTCACGCTCTCCAGTTCTCATTCAAGAGCATTGCTT
ACTACATTCGACGAGCCACCTTGATTAATCTTATCGGTCTTGCCGGTTCC
TCAAACATGACCGGGGACGACCAAAAGAAGCTTGATGTAATCGGTAACGA
GATCTTCGTCAACACCATGCGTGGTTGCGGGAAAGTGAAGGTATTGGTTT
CGGAAGAGGAAGAAGAAGCCATCATTTTCCCCGGTCATGGTAAATACGCC
GTCGTTTGTGACCCCATTGATGGTTCGTCCAATCTCGACGCTGGTGTATC
CGTTGGTACTATTTTTGGTATCTTCAAACTCGATGATGATGCCGAAGGAA
AGGCGAAGGATATGCTCAAGCCTGGAACCGAACTGGTAGCTTCCGGGTTC
ACCATGTACGGTGCTAGCGCCAATTTGGTTCTTACCATGAAGGGCGGTTC
GGTCAATGGGTTTACGTTAGACACTGCCCTTGGCGAGTTCATCCTGACGC
ATCCCGATATGAGAATTCCGAAATCAAAGGGAATCTACTCGGTCAATGAA
GGAAACTCCCTTTACTGGACCGAACCTTGCAAGGCTTACTTCGAGAGCAT
CAAGTATCCTCAGCAGCCCGGCGCAAAGCCGTACTCTGCTCGTTACATTG
GATCCATGGTCGCAGATGCCTACAGGACCCTCTGCTACGGGGGTCTCTTC
GCCTACCCCGCCGACAAGAAGAGTCCTAAGGGCAAGCTTAGGATCTTGTA
CGAGTGCGCGCCCATGGCTATGGTCATGGAGAATGCCGGAGGATTGGCCA
TCACGAGTGATCAGAGGAGAATGCTTGAGGTAGTGCCCGAACACATCCAC
GACCGTTCTGGGATCTTCATGGGATCGTATGACGAAGTCACCAAGGTCAC
AGAAGTTTTCAAGAAGCACGGTGTAGTTGCAAAGTAGGATGGATTTATTT
TCTTTCTCGCTGGTCGGTATTTTAATTGGAAGGAATGGCGTTAAGGGTAG
CTTATATAGTACCAGTACTTTAGACCGTGGCGTCTAAGGTACGAGTACAT
GGACGTTAATCCATCCATCCATTCATTCCAAATAACCCAATCGGTAGCCC
TTGACTTGTTCTATGTTCAAACTTTTTCTTCTTCTTTGCCTGCCCTGCCC
TTTTCCCTACAATTCTGTGAAGACATTGTCTGTACTGTACCTTGCTTGCT
CAAAAAGATATTTTCCCCCCT

Sequences in the Contig:

SY0AAB49YM07FM1 SY0AAC11YF17FM1 SY0AAC11YJ23FM1
SY0AAC11YM09FM1 SY0AAC11YO20FM1 SY0AAC12YH24FM1
SY0AAC12YJ12FM1 SY0AAC13YG01FM1 SY0AAC14YA20FM1
SY0AAC14YD08FM1 SY0AAC14YG16FM1 SY0AAC15YP11FM1
SY0AAC16YC18FM1 SY0AAC17YH15FM1 SY0AAC17YL11FM1
SY0AAC17YL11RM1 SY0AAC18YA05FM1 SY0AAC18YM06FM1
SY0AAC19YA22FM1 SY0AAC19YA22RM1 SY0AAC20YG24FM1
SY0AAC21YD07FM1 SY0AAC23YP02FM1 SY0AAC24YI11FM1
SY0AAC28YH07FM1 SY0AAC28YH07RM1 SY0AAC31YP19FM1
SY0AAC33YM16FM1 SY0AAC34YF04FM1 SY0AAC34YJ13FM1
SY0AAC35YB07FM1 SY0AAC35YJ23FM1 SY0AAC36YN10FM1
SY0AAC36YP17FM1 SY0AAC37YF18FM1 SY0AAC39YL21FM1
SY0AAC3YI14FM1 SY0AAC42YC20FM1 SY0AAC43YK21FM1
SY0AAC44YN11FM1 SY0AAC46YF03FM1 SY0AAC48YC08FM1
SY0AAC49YG13FM1 SY0AAC49YK16FM1 SY0AAC4YG10FM1
SY0AAC4YO21FM1 SY0AAC50YF08FM1 SY0AAC52YE07FM1
SY0AAC52YH21FM1 SY0AAC54YB09FM1 SY0AAC55YM01FM3
SY0AAC56YB11FM1 SY0AAC56YL10FM1 SY0AAC57YA24FM1
SY0AAC57YE16FM1 SY0AAC59YK05FM1 SY0AAC5YH21FM1
SY0AAC61YK16FM1 SY0AAC61YL18FM1 SY0AAC62YA23FM1
SY0AAC62YN04FM1 SY0AAC6YH06FM1 SY0AAC6YN13FM1
SY0AAC7YF01FM1 SY0AAC8YO11FM1 SY0AAC9YG19FM1
SY0AAD10YN04FM1 SY0AAD12YM22FM1 SY0AAD13YM05FM1
SY0AAD14YC18FM1 SY0AAD14YD06FM1 SY0AAD14YE02FM1
SY0AAD14YL18FM1 SY0AAD16YG12FM1 SY0AAD16YL06FM1
SY0AAD17YJ18FM1 SY0AAD17YP01FM1 SY0AAD18YP10FM1
SY0AAD21YK14FM1 SY0AAD21YL23FM1 SY0AAD22YB22FM1
SY0AAD22YI11FM1 SY0AAD24YK04FM1 SY0AAD24YK13FM1
SY0AAD25YN20FM1 SY0AAD26YA01FM1 SY0AAD27YL08FM1
SY0AAD27YM10FM1 SY0AAD29YF17FM1 SY0AAD2YN19FM1
SY0AAD30YG01FM1 SY0AAD31YA20FM1 SY0AAD31YE04FM1
SY0AAD32YJ04FM1 SY0AAD33YO13FM1 SY0AAD34YM13FM1
SY0AAD35YI10FM1 SY0AAD39YD11FM1 SY0AAD40YP05FM1
SY0AAD42YA24FM1 SY0AAD43YL09FM1 SY0AAD43YO01FM1
SY0AAD44YL05FM1 SY0AAD45YF07FM1 SY0AAD46YK17FM1
SY0AAD47YJ13FM1 SY0AAD47YM19FM1 SY0AAD48YI01FM1
SY0AAD48YL08FM1 SY0AAD48YM24FM1 SY0AAD49YG15FM1
SY0AAD4YH16FM1 SY0AAD50YA20FM1 SY0AAD50YC22FM1
SY0AAD50YI08FM1 SY0AAD51YB11FM1 SY0AAD51YF11FM1
SY0AAD53YD19FM1 SY0AAD55YG02FM1 SY0AAD56YC05FM1
SY0AAD56YJ13FM1 SY0AAD56YP16FM1 SY0AAD57YB06FM1
SY0AAD57YC06FM1 SY0AAD57YE20FM1 SY0AAD57YO23FM1
SY0AAD5YC10FM1 SY0AAD60YH02FM1 SY0AAD60YI06FM1
SY0AAD61YB21FM1 SY0AAD61YD20FM1 SY0AAD63YD12FM1
SY0AAD63YH13FM1 SY0AAD63YI03FM1 SY0AAD63YI06FM1
SY0AAD6YN21FM1 SY0AAD7YH20FM1