Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4517
Length(NT) : 1834
Best Gene Model Blast : Link to GSTUMT00005390001 E-value : 0.0
Numbers of ESTs : 18

Blast Results:

Nr Definition: conserved hypothetical protein
Accession: ref|XP_001246361.1| Score: 640 E_value: 2e-64
KEGG Definition: mitogen-activated protein kinase MAF1
Accession: afm:AFUA_2G01550 Score: 620 E_value: 2e-62
KOG Definition:
Classification: [Transcription].
Kog Number: KOG3104 Score: 363 E_value: 4e-35
PFAM Definition: Maf1, Maf1 regulator. Maf1 is a negative regulator of RNA polymerase III. It targets the initiation factor TFIIIB..
Pfam Number: pfam09174 Score: 483 E_value: 6e-49
Swissprot: Q6PGU2|MAF1_DANRE

Sequence:
>Contig4517
TTGGCTTTCTGAACTCACCAGCAAACGCCCCCGAATAAAACCATTATACA
CCATCAAATTATGTCGTCCATCGCTAGCACACTCGTTTGTTGCTAAAGTG
ACACGGTCCTAACAGGTCGGTGGATCCTTTGGCCTTAAACACCTACTCGT
GCTCTGCAGCGTTGCCGTTTGTCGAATCAAACCAGGAATCGGGGGAACGG
GGAACAATAGGGTAGTGGTCGCATCCGCACGAGCTATCTGGCCCGGCAAA
TATCCCTCTCTCTAGCTATTTCTAAGCTCATATAACCAACCCTACGCCTC
TGAATAACGAACGAACAATCTCGGCGATTTAATCAGGAATTCATATCAAG
CCCTACTTTCGATAACTTCTTTGCTTCACCAGCGACTTTTCAAATACACG
CCGACACCAACCCATCGACCGGAGCCATGAAGTTCCTTCCTCTTCGCGAG
CTTGATTCGATCAATCGTGCTCTCGTCTTCGACACTCCTGATTGCCGTGT
CGTTGGCGGTGTAGACATCTACACCACCAAGGCCGCAGGGGCTGACAAGA
AGCTTTACAAAAACGTCTGCGAAACTATCAGCACTCGCTATGAAGCCGAT
CTCCGTCTATCGGAGTCCTTATCTCCCCCTGACCGCGGTTCCGATAGCGC
TAGCAAGTACCAGTCTGCTGCCGTTTACCAAACCCTGCATTCCCCGTTTG
GACCTTTGGATCAGATTTCGGCTAGACGCACTTTTGCTTACTTGATTGCT
ACCCTTAATGCTTCTCATCCCGACTATGATTTTTCTACCACGCTTCGCCC
ATCGGACTTCCGTCGTGAGCGTCACATCAGGCCCGTTATGAACAATTTTA
ATACAACGTTGTTCAATTTAGGCGTCAACACCTCCAGAGAGCTTCCCAAG
ATGTGGGAGACTATTGATAAGGAGATGGACTTGTTGAATTGCAATATCTA
TGCCTACTCTCCCGACGATGTCTCCAACGATCCGTATGGTGACGAAGGGC
TTATCTGGTCTACTAACCTTTTCTTCTTCAACAAGCATAAGAAGAGAGTT
TGTTACCTCTACCTCAGGGGATTAAGCACCTTGAATCACTCCCCGCTTGA
GAGGAGCCTTGCCGGATGGGGCAGAAATAGTAGAGTCGGATCTGATGGAT
GGGACGAAAGTGAGGGCGAAGACCTTAACGACGACTTCATCGAGAGCAAG
AGCATCTGGGGCGACGACAACTACGATGATGGCTTTTTCGAAGGGATGGA
AGTTTGAGTTTTCACTTATCCTCAATCTTTATTATTCTGTAGATGGAGCC
GTCCATGGATAGCCTTGGGTGGTAGTATAGCTCTTGAGCTCTAACATTTC
CTTATGCTTGTACTTTTTTTGCCATCTCTTGACCTTTCTGTCTCTTGTTT
TTTTCCTTTCCTTTTCCCGGTTTTCTCGTGTTTTTTCTGTGGCGTTTCTT
ATATCCTCCAGCGGCAGTGGGTCGGATTCACCAGGAAATGCCTTCCGATA
TGTTCTGTGTATTTTTTCTTCTCTTCTCTTCTTGTTTGTAGGAATTAGGG
ATGTGGAGGGTACTTTGAGGCCGTGTTGGATTGGGCTAGTTGTGTCTGGT
CGGGGTTTGGGCGTTATCAATGTTCGGTGAGAGCGCACGTTGGGGTAATG
AACGCCTCTTGGTGTTTGGGTTAGTCTAGTTGGTGGTGATTGGTTTTGTT
TCCGGCGTTTGTTTTGGAGGTACCGAGTTTTAATTCCGGGATGAAGGAGG
GGTTCATTGATTTCGTACGAAAATCTTTCATAAGTAACTCTATTCTTGCA
TGTAATAGGGAATTGTTCTGGTTTCCCTGTATTC

Sequences in the Contig:

SY0AAA22YH10FM1 SY0AAA22YH10RM1 SY0AAA25YM08RM1
SY0AAB1YG22FM1 SY0AAC27YO17FM1 SY0AAC27YO17RM1
SY0AAC31YH16FM1 SY0AAC34YI20FM1 SY0AAC49YH11FM1
SY0AAC51YO01FM1 SY0AAC53YP15FM1 SY0AAD18YA03FM1
SY0AAD19YA18FM1 SY0AAD31YI19FM1 SY0AAD46YN05FM1
SY0AAD49YJ06FM1 SY0AAD5YJ04FM1 SY0AAD7YK01FM1