Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4516
Length(NT) : 661
Best Gene Model Blast : Link to GSTUMT00009605001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: BCS1-like ATPase, putative
Accession: ref|XP_001275665.1| Score: 249 E_value: 3e-21
KEGG Definition: hypothetical protein
Accession: fgr:FG09267.1 Score: 261 E_value: 2e-21
KOG Definition:
Classification: [Posttranslational modification, protein turnover, chaperones].
Kog Number: KOG0743 Score: 198 E_value: 2e-16
PFAM Definition: BCS1_N, BCS1 N terminal. This domain is found at the N terminal of the mitochondrial ATPase BSC1. It encodes the import and intramitochondrial sorting for the protein..
Pfam Number: pfam08740 Score: 137 E_value: 2e-09
Swissprot: Q9P6Q3|BCS1_SCHPO
Gene Ontology:
GO:0005739 = Cellular component: mitochondrion

Sequence:
>Contig4516
TTGGCCCATGAGCCATGCCGTTCGAAGGTACAGCTCGTACGGTCCGTTTG
GAGACGGCGCAGGCAGAAACGAGGATGACGACGACGAAGAGGTTGATAGT
GATGAAGGTGGTGGATGTGCGGAAGAGGACAGGTTAGGTCCAAAGCTCAA
GTATACACCCGCTCCTGGGTTTCTCCACTTCTGGTACAAGAGGAATTTAA
TTATCATTAATCGTAAATTGGACCTGTCGTATTACACAGGCGATATTCCA
GACGAAACCATGGTAAGTAATTATCACCCCGCACTTTTGTGTGCTTTCTT
TCAGCTCACTCAGATGCTTGGCAGGTACTAACCACCGTCGGCCGTTCGCC
AACCCTCCTTCGCGAGCTTCTTGCTGAAGCACGGAAGGAGTATCTCCAGG
CGCAGTCAAGGAAAACTATGGTATATACACTTTCGCCTACACCGTTCGCT
CAAAAGAACTGGGACCAAGGCCGTCATCGACCTTCCCGCGATATCTCTAC
TGTCATCATGCCTCGGGGCTCTAAATCTCATCTCCTTCGCGATGTCAAGG
AGTATTTGAACCCGGTAACTGCTCGCTGGTATGCTCAACGCGGTTTGCCA
TACCGCCGCGGGTATTTGTTCTATGGGCCACCTGGTACTGGGAAAACAAG
TTTGAGCCTTG

Sequences in the Contig:

SY0AAC34YI16FM1 SY0AAC48YB22FM1