Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4515
Length(NT) : 819
Best Gene Model Blast : Link to GSTUMT00010270001 E-value : 0.0
Numbers of ESTs : 2

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition:
Classification: [Transcription].
Kog Number: KOG0147 Score: 151 E_value: 6e-11
PFAM Definition: DUF1777, Protein of unknown function (DUF1777). This is a family of eukaryotic proteins of unknown function. Some of the proteins in this family are putative nucleic acid binding proteins..
Pfam Number: pfam08648 Score: 158 E_value: 9e-12

Sequence:
>Contig4515
TTGGGCGCCAAGTTTCTCTTGAACACCTGCAGCAGAATTTTCAGGATGCA
CAATTTCAACAACAAATACAAGGAATTGATGAAGCTGTTGCTGCCGTCAC
CACCAGTGGCGAAAAGAAAGGAGAAAAAATCCAGTCTGTTGTGTCTGAGG
ACCTTGATAATATAGCTGATGCAATCGATGTACCTACTGATTCTGCCTCT
ACCGTTGTGGTCGGAGGAGCAATTGGTACTACTGAGGATCTCGCAGAATC
ATACAATTCGATAACTCCCGTGAATCCTGACATGGCTGCTCAGTATTTTC
CCACTGATGATTTTAGATCGCAGGGCTTTCAACAACAGCAAGTTTACCCC
ATGCAGTTTAATAATGGCTTTAGAGGGAGCCTTAGACGCGGTGGCTTCCG
TGGAGATTTTATGGGAGGCCCTAGAGGAGGCGGACATGTCGGGCCCATCC
CAGCTGCACCCGGATCCATGGATGGCGATAGAAGACCCATTGAAGGAATA
GGACTAGGCGTTGAAGGAGCCCCTACAGGACCTAAAGCATTGAGAGAGAG
AGGATTAAGCCGTAGTGGACCACCCATTAGAGCAGGTTATATTGGACGCA
GAGGAGGGGGGTATCCGGTATCGTCATGGACTAGAAGTATCTCGCCCGAC
CACGCCTTTTCCAGATCCAGGTCACAGGATAGCCGGCGCCGTTCCAGATC
GCCAGATCGAGGGCGCAGCCAGGAGAGAGACAGAAGTAGGGACCGAAGCC
GCGATCGTCGTAGAAGTATAAGAAGCCGAAGCCGTCACCGGAAGCACCGT
TCCCCATCCGTTGAAGTAA

Sequences in the Contig:

SY0AAC34YI01FM1 SY0AAC61YC16FM1