Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4513
Length(NT) : 1063
Best Gene Model Blast : Link to GSTUMT00006653001 E-value : 0.0
Numbers of ESTs : 3

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4513
TTGGCCAACTTTTTTGTACAAAGTTGTCCCCCGGCCCTATTTCCAGCTGC
GGTTGTGAAGTTTATTTTATTTTTTACTTCTTCAGATAGTTACGATAATA
ACTTGACTTACCCCGCTTGCCGAATAGCCCACAGATATGGATGCCTTATC
CATCTAGCCTTTATTTTGCTTTATTTTTTTGATTGAGGAAATATTTCCTT
TCACTTTTCCCCTATCACTTCTTCCTTCTTCCCTTCCACCTCTTTTCTTG
AGTTGGCTTGGTTGAGCTGGTGAAAGTCAAATGCCGCTTGACAGCCTCTC
TAACACTTCTACCAGTGCGCTTTTAAAACGTACTAGAAGGGCGCGGCCCC
GTACACTTTCCATACAGTCAACGTCCACAACCTCAGCACTTTGCTGCGGC
GGCTACTTCTTCTCACGGCCTAATTGTGGCCTAGGCCCAGCGGTAGCGGC
AGGGAGGGTGCACCGCCAGTGCCTTCGGCCGACTGGGAGACGACAGCCGC
CAAGTGCATATAGACGCACCTCCGCGCTCTATTCTTCTTCGTTTAGTCCT
TCCCCAAGAATCGGGGGGAAGGAGGAGAGGGGGAAATCATGCCACCCTAC
AATTCAAACAACCTTGTTCTTATAACCTTTGTTGGAGCAGTCATTATCTT
TGTTCGAGCCTATAAACAACTAAAGCGCCGGCGGTTATCACAGCAGGAGA
AGAACAAGAGAAGTAGGGTGAAGGATGGTGGTGGTACTATGAGGGAGACA
GACGAGGTAAAAAATGTGGGTACCCCAAAGACCGGGAGACGGCTTTTCCG
TAACCTTTTCTCGAGAAACCGGGAAACGGCGGCGTCTAGGCTCCCGCCCC
CGGTCGCGATAATGACCGGGGAGTCGGGGGGACTGTCACAGAATGTGAGA
GAGATGGTGGAGGATTGGTTTCACAGGGAGCGCGAAGCTACCAATGGTCA
TGGCATTCGGTCTGCTCGCGAACCTCCGAGTATGGGCATGTATGAGGGCG
TGACTGCACCGGTAGTTCCGGTTGCTGGTAAAATTGAGAGGATGACCGGG
AACGTCCTCTCCA

Sequences in the Contig:

SY0AAA53YE20FM1 SY0AAB61YB24FM1 SY0AAC34YH19FM1