Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4512
Length(NT) : 982
Best Gene Model Blast : Link to GSTUMT00010872001 E-value : 0.0
Numbers of ESTs : 8

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4512
TTGGGAAGGAAAGAATAGAGGGAGGCCGGGCGTGTGGGAAATAAATTTAA
ACCCCCTGGTTCCCGCTCCTCTCCCCTCCTGCGGCTTCATTTTGTTTATC
TTTTCGATCGTTATCTCGGCTGTTTTGAAAGCATTCTATTTCGGCCTTCG
GGATTATTCCATGATCCAGCTAGCACTGTCACTACCGACACAACAGACGG
ACCAGTACCATCAACTTATCATCCGGCCCCATTGATCTACCTACCTGTTC
ACTTAAGCATCCGTCAACCCTCTTCGCTCGATCAAATACCCCCGGGATGT
CCATTCACAAAACTTCCACAAGCACCCTCTCCACAACCTACTCCTCTTCC
TCCTTCACAACTCACTCACCGCCACGCCAATGCTCCACCCTAGACCCCCT
AAAGCCTGAAGCTACTTCCCGTACCCCAGTTTACCCTCGGGCCCGTCCTC
GTCAGCGAGCCAGTCCTTGTTCACGAGCCGGCACAACACCCGCCCGGAGC
TGCCCCCAAACACAAACCGCGAAGCCAAAAAAATCCCTTCCGAAGAAGAT
CCTAAGTGGCACCGGTCAGGTCCTTGGCTTCTGTGCATGGGTCCTGTGCT
TCTCCTGCGTTCTTTCAGGAGGCCGGGGATTTGATGAGAAGCATCCTCAT
CAGCCACTGTGATCGACGGCGGGGGGGGGTGACAGTGCAACCTTGAGGCA
AGGCTGTTGATAAGACCAGTGATAGTTGCACGAGTAAATTTGTAGCTGGA
AGTTCTGGGCGTTTGTCTGCGGTTCCCTTTTCTCTTTTTTTGACCTTCGG
GCGTTTGGTTGCTTTTTCGCGGTGTTGGAACGGAAACCTATTCGTTGCTG
GGACTCCGCTACTTTCCATTTTTCTTTTGGTTAGGTTTGATGCTTGGATT
GGATGGCAACGGAGGTGGGCAGTGAGAGGAATCCGATCTACCAAAGGTAG
CGATTTCTTGTATGATACTTTAGCATTAGCGT

Sequences in the Contig:

SY0AAA45YG18FM1 SY0AAA63YJ22FM1 SY0AAA63YP23FM1
SY0AAB51YN17FM1 SY0AAB53YB15FM1 SY0AAC34YH16FM1
SY0AAC44YM03FM1 SY0AAD35YO22FM1