Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4511
Length(NT) : 763
Best Gene Model Blast : Link to GSTUMT00002747001 E-value : 0.0
Numbers of ESTs : 11

Blast Results:

Nr Definition: ATP sulfurylase
Accession: ref|XP_001594508.1| Score: 432 E_value: 1e-70
KEGG Definition: hypothetical protein
Accession: ncr:NCU01985.1 Score: 416 E_value: 5e-68
KOG Definition:
Classification: [Inorganic ion transport and metabolism].
Kog Number: KOG0636 Score: 188 E_value: 3e-15
PFAM Definition: ATP-sulfurylase, ATP-sulfurylase. This family consists of ATP-sulfurylase or sulfate adenylyltransferase EC:2.7.7.4 some of which are part of a bifunctional polypeptide chain associated with adenosyl phosphosulphate (APS) kinase pfam01583. Both enzymes are required for PAPS (phosphoadenosine-phosphosulfate) synthesis from inorganic sulphate. ATP sulfurylase catalyses the synthesis of adenosine-phosphosulfate APS from ATP and inorganic sulphate..
Pfam Number: pfam01747 Score: 252 E_value: 1e-22
Swissprot: Q1EAF9|MET3_COCIM

Sequence:
>Contig4511
TTGGCCGTTCCCATTGGCCAGTTGTCAGGGCATATTATCTTTGGTTTCTA
CTCTGATCCGTTAATTACTCTTCCCTTATCGCCAGAATGTCGGATTTGCC
GCAACCCCATGGGGGTGTCCTCAAGGACTTGATTGCTAGGGACCTTCCTA
GACACGCTGAACTCCTCGCTGAGTCTGAGACTCTTCCAGCTTTGATTCTT
ACCGAGCGTCAACTTTGTGATTTGGAGCTGATTCTGAGTGGCGGATTCTC
TCCTTTGGAGGGGTTTATGAACGAGAAGGATTACAATGGGTTTGTCAAAA
GCATCTTCCGGGATCTAGGGGTGAATTAGTGAGTGAGTATTAACGTTGAG
ACAGAGTTGTTGGGAATCTTCGTCTCGTGGATGGAACACTCTTCTCCATG
CCTATCACTTTGGATGTTTCCAAGGCTCAGATCGAGGAATTGGGTGTCGA
GGTTGGTGCGAGAATCACGCTCCGTGATTTCCGTGATGACCGCCACTTGG
CCATCATTACTGTCGACGACGTCTACAAGCCTGACAAGCAAAAGGAGGCC
AAGGAGGTCTTGGGCAGTGATGAGGAGCACCCTGCTATCCGCTATCTGTT
CAACACTGCCCGGGAATATTATGTTGGTGGGAAGATTGAGGCCATTAACA
GGCTCAATCACTACGACTACGTCGGCTTGAGATGTTGGTGATCCGGATCG
GCGCGACATTATTGTAAGGTGCTAATATGGTGACACAGACACTCCCGCCG
AATTGAGGTTGCA

Sequences in the Contig:

SY0AAC34YH07FM1 SY0AAC44YP03FM1 SY0AAC54YN11FM1
SY0AAC62YC23FM1 SY0AAC62YK07FM1 SY0AAC9YH04FM1
SY0AAC9YM05FM1 SY0AAD43YL24FM1 SY0AAD46YL20FM1
SY0AAD9YD11FM1 SY0AAD9YJ18FM1