Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4510
Length(NT) : 1268
Best Gene Model Blast : Link to GSTUMT00004092001 E-value : 0.0
Numbers of ESTs : 6

Blast Results:

Nr Definition: hypothetical protein SS1G_06975
Accession: ref|XP_001591529.1| Score: 623 E_value: 4e-87
KEGG Definition: hypothetical protein
Accession: ang:An18g04400 Score: 628 E_value: 7e-84
KOG Definition:
Classification: [Signal transduction mechanisms].
Kog Number: KOG1487 Score: 579 E_value: 3e-60
PFAM Definition: MMR_HSR1, GTPase of unknown function..
Pfam Number: pfam01926 Score: 232 E_value: 5e-20
Swissprot: P39729|RBG1_YEAST
Gene Ontology:
GO:0005737 = Cellular component: cytoplasm
GO:0005515 = Molecular function: protein binding

Sequence:
>Contig4510
TTGGCATGTCTTTACATCTACAGTGGCCAAGGCCGATGTTTGCCGGGAGG
ACATTGAAATATAAAAAGTAAATGCCCGTAGGACAGGAATAAGCAATCCT
ATTGCATGGAATCGTGCTGGGCCTTTTACCAGCAGGGAAATTACATTTTC
CGTTGTTAAGTTTCGTTTGTCGTTGCCCCAACAATCCATTGGTGGGGCAG
AATCAACATCTTCCCCGCGTGTCCAGCTTGCCACACTCTGAATCTTTTTT
TCTCACACGTCTCCCAAGACATCCACACCACTCTCCGCTCTGTACCTACT
TCAACGCCCGACGAAATAGCGATAACAGAAAAATGAGTACTACTGGTAAG
GGTTGCTATCCTGTCTGGGGGCAGGCGAGGATCTAATAGCCGATTAGTGG
AGAAAATCAAGGCCATCGAAGATGAGATGGCCAAAACCCAAAAGAATAAG
GCAACGTCTTTCCACCTGGGCCAATTGAAAGCAAAACTCGCCAAACTACG
AAGAGAACTCGTGACTCCCTCCTCCTCTGGAGGGGGTGCTGGGATTGGCT
TCGACGTCGCAAGGACTGGTGTGGCCAGTGTGGGGTTTATTGGTATATAC
TTAGGCTCTTGGCTATAGGTATTCCATAGGGTGAAGTGCTCATTAAGCTG
TAGGGTTTCCTTCAGTCGGTAAGAGTACTCTCTTAAATCTGCTCACGGGC
ACCCACTCTGAGGCAGCGGCCTACGAATTCACGACCCTTACGACTGTTCC
CGGCTGTGTCATGTATAATGGCGCCAAAATTCAGATGTTGGATCTCCCCG
GAATTATTCAGGGTGCAAAGGATGGAAAGGGTCGAGGTCGTCAAGTGATT
GCGGTAGCGAAGCAATGCAACCTTATATTCATTGTGCTGGATGTCAACAA
ACCGTTAACCGATAAGAAGATCATCGAGCAAGAGCTGGAGGGGTTCGGTA
TCAGGATTAACAAGCAGCCACCAAACATTGTTTTTAGGAAGAAGGATAAG
GGAGGCATTAGTGTCACTAGCACCGTGCCACTTACTCATCTTGACGCTGA
GGAAATAAGAGCGGTTACAACAGAGTAAGTCCCTGAACCCGTTATTGCGA
AAAATGAGGAAAAAGGAAAAAAAGCACTTGTGGTCCCCTTTTGGACCTAT
ATCATCGCGGTATTATTACCCGAATCGATGGTGTTACGATTTAAGCCAGT
GCGAACCCTATAATATCAAGAGATTCCGGTTCAACTACGCGTCGCCGTAC
CAGAATTTTGTGGGCTAC

Sequences in the Contig:

SY0AAA53YI22FM1 SY0AAB12YK03FM1 SY0AAC34YG20FM1
SY0AAD41YJ11FM1 SY0AAD43YM11FM1 SY0AAD49YD10FM1