Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig451
Length(NT) : 695
Best Gene Model Blast : Link to GSTUMT00001345001 E-value : 0.0
Numbers of ESTs : 7

Blast Results:

Nr Definition: hypothetical protein MGG_08260
Accession: ref|XP_362788.1| Score: 528 E_value: 4e-52
KEGG Definition: hypothetical protein
Accession: mgr:MGG_08260 Score: 528 E_value: 2e-52
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig451
TTGGCCCACCCGCCTAACCATCAATAGTCTAACGTACTGCAAGTACTACC
AAACCACGAACAAAAATAAGGACACAAGACCGCCTCAATGTCCGCGGACA
GAGAAGACCCAGTCCAAGTGCTAATCCTCGGCGCTGGTTGGACCTCCACA
TTCCTGATCCCCCTCCTCGAGGACAACAAAATCACGTACGCCGCCACGAC
CCGCAAAGGCGATGACAACTCCATACCCTTCGAATTCGACCCGCAGTCCG
ACGACCCGACGCCGTTCCTGCCCCTGCCGTCGGCAAAGACCGTGCTGATA
GCCTTCCCGATCAAGGGCACCGGCGGGTCGAAGTTGCTCGTGACGCTCTA
CATGCGCACGCACCAGCACGTAAAGACGAACTTCATCCTATTAGGCACCA
CGGGGATCTGGCCGGACAAGGGCCTTCATGACCGCTTCACCATCCCGTTC
CCCGACAATCCGAGGAAGATTGCCGAGGACGAACTGCTCTCTCTCGGCGG
GGCCGTGCTGAATCTCGCCGGACTGTGGGGCGGCAGCCGCGACCCGAGGA
ATTGGGTCGGCCGCGTGGCGCCGGATAAGGAGGCGCTCGCGGGTAAGGGC
TCGCTCCACTTGATTCACGGTTGGGACGTTGCGAGGTCGATTATCGCCGT
TCATAAAGCTTTCACTCCCGGGGAGAGATGGCTCATCACGGATCT

Sequences in the Contig:

SY0AAA24YF02FM1 SY0AAA24YF02FM2 SY0AAC22YI17FM1
SY0AAC48YL14FM1 SY0AAC51YI02FM1 SY0AAD10YC05FM1
SY0AAD29YP22FM1