Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4509
Length(NT) : 732
Best Gene Model Blast : No Hit Found
Numbers of ESTs : 4

Blast Results:

Nr Definition: No Hit Found
KEGG Definition: No Hit Found
KOG Definition: No Hit Found
PFAM Definition: No Hit Found

Sequence:
>Contig4509
TTGGCATCACCTCTTCCACCACCACCACCACCACCACCACCACCATCCAG
CTCCACACTTCCCCCTTCCCTCCTTTTACCTTTCCCTCCCCCCCTTCTCT
ATCCAGCGCTATGATGACCCTTCGGAGCACGGACTAGGGGCGCAGACGTC
AGTCCGGATAAAAAAAAAATGATAAATGAGTGAAGTGCGCTGTTCACTGA
TCAAACTCTCACGAACCAACAAACGCCGGAATATCAATTTCACAAGGTTC
ATTTCTTCCTTCCCCTTCCATACTCTCTTCCCATACCCGCTTTGTTAGTG
GCAGCTCCGTTTTGCTTTGGTTTGCGGTCGAGTTAGGTTTCAAGGAAGAT
AATTACGCACTACGGTACCAAAGCACCACACTACCAGACAATTACTCTAC
CACCAGAGGAAGGAGAGGAATAAGTAGGAGAAACAGCTCCGGGTCCGACC
GTTCGTTCACTTACACCCGAACAACCAAAAATTCTGAGACAAGCTTTCCC
CATTCGCCTGCAGGAAACGGGTTTTCTTTCTTTCTTTCTTTCCTTATTAC
GCCCTATTGCATTATTATTTTCAACCTCTAAGCTTCTTTTTTTGGGGCCC
ACATTTATACTTGGGGGGAGGGTTTTCTTTTAAACCATACGTACACATGC
GTTACGGCGCTCCGAACGAACCCATACCCTTAAGGCTGTAACTTTACCTA
GCCCGAATCCACCATTCCCTGCCGCACGTTGG

Sequences in the Contig:

SY0AAB34YC22FM1 SY0AAB57YL07FM1 SY0AAC34YG17FM1
SY0AAD12YL17FM1