Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4508
Length(NT) : 2382
Best Gene Model Blast : Link to GSTUMT00009538001 E-value : 0.0
Numbers of ESTs : 16

Blast Results:

Nr Definition: hypothetical protein BC1G_06998
Accession: ref|XP_001554410.1| Score: 829 E_value: 3e-86
KEGG Definition: hypothetical protein
Accession: ang:An11g03610 Score: 777 E_value: 1e-80
KOG Definition: No Hit Found
PFAM Definition: No Hit Found
Swissprot: Q00808|HETE1_PODAN

Sequence:
>Contig4508
TTGGGTATCTACCAATCAGGTGAGAAGTTACAAGTAGAAGCTGTAAAGAC
GACCTGAACGCCTGCAGTGAGTGGTGAGGGGCCAGCCGAGTCGCCTGGCC
TCACGCCGACCATTTTGTGCTCTCAGGAGAGGAGTAGTCCCCAGGCTCCC
CAATCTCTTTGACTCTTCTATTCTTTTCCACCTGGTCGAAAGTTACCTTT
ACAAATCGAAAAGGAGTCAACCAATTCTCTAGTCGGCAAAACGCAGCTTC
TCACAATCCGGGTATCAATTGATAAGATGGGAATTTGGCAATCAAGAACT
GGCGAGGACTATTCTTCACCGCAAGGCAGCGGTGATTCTAGTTCCGGGGC
CAATATCCATATTAGGGGCGACAATTGCGGCAACTCCGGTTCTCATAATA
AGTTCTCCTCCGACAACACCACCATCTTCAATTTCTGGGGCGGCACAAAC
TCCTCCCAGAACCATACAGAAATTTTACAATTCCTATACACGTCCAGCTA
TGAGTCGCACCGAGGGCGGGTTCGTGAGCCGACCGAGGGAACGTGCGCTT
GGGTTACGGAACACCCAAGGTACAAGGACTGGTCGGAGAAGAAGAAATCA
GGTCTCCTCTGGCTATCGGCAGACCCAGGTTGCGGGAAATCGGTCACCGC
TTCGTTCCTCATCACACACCTAAAGACACAAACGGATGCCATCGTTTGCT
ATTTCTTTTTCAAGGACGACAGTGATGAGCAGAGGAGCCCAACATTTGCT
CTTTGCGCCCTGCTGCACCAGCTCTTTGTACAGAGGAATTCCCTCTCTAG
ATATGCCGAGCAAGCGTTTAAGGATAAAGGAAAGAGGTTCACGGAGGAGG
TGGACACATTGTGGAATATTTTGGTTAGGGCGGTAGCTGAGGGGGGGTGC
GGCAATGTGATCTGTGTGGTGGACGCCCTAGACGAGTGCGAGGAAAGGAC
TCTAATCCCACTTATCCGCCACATCAACAGCCTCCCGGGATCACTGACCT
CCAATATACCCTTGAAATTCATCGTTACGAGCCGCCCATACCACAGAATC
GAGATAGAACTTAGCTCACCCGAAACGACGATCCGCTTGAAAGGGGAGGA
CGAACTCGACGCCATTACTTCTGATGTTACTCGTGTCATAGACGAGGGAA
TTAAGAGCCTAGAGTCATACTGGGGACGGCCTGGAGGGCTGGAATATTTG
CGAAATCTCTTAGAATGTTCGGCCGATCGGACATTCCTATGGGTTTCTCT
GATTCTCGGGATTTTGAGGAATAGTGTGGACGACTCACCGGAAGTGCTTA
CTACAATTGTCTCCGCTGCTCCGCGCGATCTAGCAGAGTTGTACACCAAG
ATCCTCGATAAAAGCCCGCACCCCGAGAGCGCCCGACGAATCCTGAATAT
AGTTGTAGCTGCTGCGAGGCCTCTTACACTTCGAGAAATGAACACGGCAT
TCAGAATCAGGCCGGAGCACAGCTCGGTTAAGGACCTCGGCGATCTTGGT
AGTGGAATGGAAAGGACAGTGAAAAATTTGTGTGGGCTTTTCGTGCGAGT
TATCGATTCGAAGATCTACCTGGTTCACCAAACTGCAAGGGAGTTCTTGA
TTCGCGAATCATCGGCTGGCCAGGGGAACTGGCAGCACACACTGTGTCTC
GAGGACTCTAATTTCATCATGGCTAACATTTGTTTCTCCTATCTTTCTCT
AACGGAGTTTGAAAACGACCCTTTGTCCGGGAATACTTACGGCATGGATT
GGCCGTTTCATCGGCGCGAGGTTGATGATTATCTGGAGAAATATGCCTTT
CTCGAGTACGCCGCGAGTCACTGGGCGGACCACTTTCGCGATTCGCAGGA
TCGGCAGGTGGAGTTATTCGAGTTCATAAGAGAGATTTGTGAAGCTGGGT
CTAAACGATCCCAAACATGGTTTAAGGTTTGCTGGGTTAACTCCCGCCAC
GGGTATGTATGCCCCACAGATTTGACACATTTGATGATAGCATCGTGGCT
GGGGCAAGGGAGGGTAGTGGAGCGACTACTAGAGGAAGGGGGAGATATCA
ATGCTCGATCGGAGGTATATGGCACCGCATTGAATATAGCCGCTATCCGG
AGAAACGAGAATATTACCAAAAAGCTGCTGGAAAGGAATGTCAAAGCATA
CTTCGATGAGAAGGAGTATAACATTTTGCAAACAAAGAGGGTAAGTGAAC
GGCAATAGGGATCTTGGGCAATCGTCATGACTAACCCTGGGATGACCCAT
GAATGTAGAGTGAGCTTAAGGAGTTGCGAGTAAGGGCACAGGATCAACGA
CGGTTGTGGGATGAGGTGATTGCTGACCATTGGCTCGCGGAGTGTTATAG
TTGGTAAGTGCACGGGATCAATGACGGTTGTG

Sequences in the Contig:

SY0AAA21YI09FM1 SY0AAA25YH10FM1 SY0AAA53YL13FM1
SY0AAA54YB09FM1 SY0AAB28YB24FM1 SY0AAB3YN03FM1
SY0AAB57YO11FM1 SY0AAB59YD15FM1 SY0AAC14YD24FM1
SY0AAC33YG02FM1 SY0AAC34YF23FM1 SY0AAC43YD16FM1
SY0AAC46YD02FM1 SY0AAC59YE19FM1 SY0AAD15YF11FM1
SY0AAD47YC03FM1