Tuber melanosporum DB

You are here: MycorWeb Genome resources Tuber melanosporum DB EST & Gene Sequences -> Contig card

Contig Name: Contig4507
Length(NT) : 986
Best Gene Model Blast : Link to GSTUMT00010835001 E-value : 1e-114
Numbers of ESTs : 3

Blast Results:

Nr Definition: hypothetical protein CHGG_04677
Accession: ref|XP_001223891.1| Score: 300 E_value: 2e-25
KEGG Definition: hypothetical protein
Accession: ang:An02g03160 Score: 207 E_value: 3e-24
KOG Definition: No Hit Found
PFAM Definition: RGS, Regulator of G protein signaling domain. RGS family members are GTPase-activating proteins for heterotrimeric G-protein alpha-subunits..
Pfam Number: pfam00615 Score: 133 E_value: 1e-08
Swissprot: P38093|FLBA_EMENI

Sequence:
>Contig4507
TTGGCCAACCTTTTTTGTACAAAGTTCTCCCCTACAATATGGATTGGTCC
AGTCTGCTTTTGAGGATAAGGCCTGCATTCAGGCTAACCCAAAGGCAAAA
GATTTTCAACCGACCAAAAATGCCATCTACATTTTCACCGACAAAGGGAA
GAGAGTGTCGGGATGGATTGATGGCGACCGGTTGAGTCTGCAGAATGGAG
ATAGGGGAAGTGACGGAAACTCCGTACGAGGCACATCCAAAGGTAGGAAC
CGGGAGGAAGGGTTCCCTAGAGGCAAGTGTCCACCCCACGGGGAGTGTGG
GGATGCACTGGAGAGGGATAAATTGGGTTGACTGGTGATATAGATCAACG
TGAGACTAACACTACCCGGCTGACCGCTATCCTTAACGACGCTGCTTTGA
GGTTGTTGTTCCGCGAATACCTTCGGGAAACTGTATGCGAGGAAAATCTG
TCATTCTGGCTGGATGTTGAGGATTTCAATCACAATTTCCTTGCAATTGA
TAAGTCGAAACCTGATGCTGTGCGAGAAACCTTAGCGGCTGCCTATGGTA
GGTAAAACAATTTTTTATTGGCTACTTTTGTTGTTTCTAGAAGATGGCCG
CCATCGCGCACTTGATTTCTGGTAGTGCTCTCCCTAAACCGGTTTACTCG
GTGACTGCACAATAACTCCATCTCCCTGTTGGCCTTCATCTACGAAATCT
GGACGCTGACCGAATACTTTTTTTTCTGTTGCTTAGGCCTTTACAACGCA
TTCCTTGCCCCTGGATCCCCATGCGAATTAAATATCGATCACACGCTTCG
ACAAGACATGGCCTCTCGAATGACCCGAGCTGTTGCAAAGGACGAAAATG
CAATGTACTCCAGTTTGAAGGAGGTGGCCGCTCTTTTTGACCGAGCGCAA
CAACAAGTGTTCAAACTCATGGCAGGAGTAGGCATTCTTGTGATCTCGCG
CTTAAAAACGACAGCTGACTCGCTTTCGTTATAATA

Sequences in the Contig:

SY0AAC34YF22FM1 SY0AAC48YP11FM1 SY0AAC4YB02FM1